Run BLAST — run_blast • BLASTr

Run BLAST for a single sequence and return raw results. For formatted results, use the function [BLASTr::get_blastn_results()].

Usage

run_blast(
  asv,
  db_path,
  num_alignments = 4L,
  num_threads = 1L,
  blast_type = "blastn",
  perc_id = 80L,
  perc_qcov_hsp = 80L,
  verbose = c("silent", "cmd", "output", "full"),
  env_name = "blastr-blast-env"
)

Arguments

asv: Vector of sequences to be BLASTed.
db_path: Complete path do formatted BLAST database.
num_alignments: Number of alignments to retrieve from BLAST. Max = 6.
num_threads: Number of threads to run BLAST on. Passed on to BLAST+ argument -num_threads.
blast_type: One of the available BLAST+ search engines, #' one of: c("blastn", "blastp", "blastx", "tblastn", "tblastx").
perc_id: Lowest identity percentage cutoff. Passed on to BLAST+ -perc_identity.
perc_qcov_hsp: Lowest query coverage per HSP percentage cutoff. Passed on to BLAST+ -qcov_hsp_perc.
verbose: Should condathis::run() internal command be shown?

<<<<<<< HEAD

env_name: The name of the conda environment used to run command-line tools (i.e. "blastr-blast-env").

=======

env_name: The name of the conda environment with the parameter (i.e. "blast-env")
gapopen: Gap open penalty (default = 5 for blastn, = 11 for other blast)
gapextend: Gap extend penalty (default = 2 for blastn, = 1 for other blast)

>>>>>>> local update to lucio's version

Value

Unformatted BLAST results. For results formatted as tibble, please use [get_blast_results()]

Examples

if (FALSE) { # \dontrun{

dna_fasta_path <- fs::path_package("BLASTr", "extdata", "minimal_db_blast", ext = "fasta")
temp_db_path <- fs::path_temp("minimal_db_blast")
make_blast_db(fasta_path = dna_fasta_path, db_path = temp_db_path)
asvs_string <- "CTAGCCATAAACTTAAATGAAGCTATACTAAACTCGTTCGCCAG
AGTACTACAAGCGAAAGCTTAAAACTCATAGGACTTGGCGGTGTTTCAGACCCAC"
blast_res <- run_blast(
  asv = asvs_string,
  db_path = temp_db_path
)
} # }