#navigate to raw-data folder
cd $raw_data_folder/$run_folder;
#authenticate to BaseSpace (only at first log in)
bs auth;
#list datasets from runs on your BaseSpace
bs list datasets;
#create folders to organize fastq files
mkdir ~/runs/run_01mar21/fastq/; #edna
mkdir ~/runs/run_09fev21/fastq/; #edna
mkdir ~/runs/run_29jul20/fastq/; #edna
#download runs from BaseSpace
bs download project -n fish_eDNA -o ~/runs/run_29jul20/fastq/ --extension=fastq.gz; #primeira corrida LGC
bs download project -n eDNA_2run_B -o ~/runs/run_09fev21/fastq/ --extension=fastq.gz; #segunda corrida LGC
bs download project -n iSeqRun2_Daniel -o ~/runs/run_01mar21/fastq/ --extension=fastq.gz; #amostras iSeq ecomol
#organize all fastq files of each run in a single folder
mkdir ~/runs/run_01mar21/fastq/all;
mkdir ~/runs/run_09fev21/fastq/all;
mkdir ~/runs/run_29jul20/fastq/all;
#move all fastqfiles to a single folder
mv ~/runs/run_01mar21/fastq/*/*fastq.gz ~/runs/run_01mar21/fastq/all;
mv ~/runs/run_09fev21/fastq/*/*fastq.gz ~/runs/run_09fev21/fastq/all;
mv ~/runs/run_29jul20/fastq/*/*fastq.gz ~/runs/run_29jul20/fastq/all;DNA metabarcoding of mock communities highlights potential biases when assessing Neotropical fish diversity
Abstract
Despite the increasing popularity of DNA metabarcoding in the assessment of aquatic ecosystems using fish eDNA or ichthyoplankton, challenges have hampered its broader application in the Neotropical freshwaters. Using five mock communities composed of fish species from two Neotropical river basins, we evaluated the influence of DNA concentration and choice of mitochondrial 12S molecular markers (MiFish, NeoFish and Teleo) on species detection and Relative Read Abundance (RRA) using DNA metabarcoding. Of the three 12S markers analysed, only MiFish detected all species from all mock communities. The performance of a taxonomy-free approach using ASV/MOTUs was not as precise as assigning DNA reads to species using a curated 12S library that includes approximately 100 fish species, since more than one ASV/MOTU was observed for the same specimen. Thus, here we showcase the importance of a custom reference database to allow precise assignment of Neotropical fish species in metabarcoding studies and that the RRA is dependent on community composition, marker and DNA concentration. We highlight the importance of controlled experiments using known species communities before large investments are made in assessing biodiversity using non-invasive methods that apply DNA metabarcoding.
Bioinformatics
Data acquisiton
Download demultiplexed samples from Base Space using the bs interface.
Load R libs and system programs
# 0 - load libraries ----
{
library(dplyr)
library(tidyr)
library(tibble)
library(stringr)
library(ggplot2)
library(ggbreak)
library(ggtree)
library(phyloseq)
library(Biostrings)
library(Matrix)
library(ShortRead)
library(dada2)
library(DECIPHER)
library(future)
library(vegan)
library(ape)
library(phangorn)
library(adegenet)
}
#set complete path to cutadapt executable
cutadapt <- "/usr/local/bin/cutadapt"
#important
prjct_path <- "~/prjcts/fish_eDNA/sfjq"
notes_path <- paste0(prjct_path,"/notes")
results_path <- paste0(prjct_path,"/results")
figs_path <- paste0(results_path,"/figs")
prcj_radical <- "SFJq_fish_metabarcoding"
#path to project data folder were the processed reads will be stored
data_path <- paste0(prjct_path,"/data/reads")Quality control
Chech overall quality of sequencing runs for all samples
Demultiplex SFJQ sample (MiFish & NeoFish mixed)
#Demultiplex SFJQ sample (MiFish & NeoFish mixed)
#samples MiniSeq LGC
cutadapt -j 79 --no-indels -g file:~/prjcts/fish_eDNA/sfjq/data/primers_neo_mi.fasta -G file:~/prjcts/fish_eDNA/sfjq/data/primers_neo_mi.fasta -o ~/runs/run_09fev21/fastq/all/sfjq_dmx/SFJQ-{name1}-{name2}_R1_001.fastq.gz -p ~/runs/run_09fev21/fastq/all/sfjq_dmx/SFJQ-{name1}-{name2}_R2_001.fastq.gz ~/runs/run_09fev21/fastq/all/SFJQ-neo-mi_S23_L001_R1_001.fastq ~/runs/run_09fev21/fastq/all/SFJQ-neo-mi_S23_L001_R2_001.fastq 2> ~/runs/run_09fev21/fastq/all/sfjq_dmx/cut_SFJQ_demux.txt
cp ~/runs/run_09fev21/fastq/all/sfjq_dmx/SFJQ-neo_FWD-neo_REV.* ~/runs/run_01mar21/fastq/all/
cp ~/runs/run_09fev21/fastq/all/sfjq_dmx/SFJQ-mif_FWD-mif_REV.* ~/runs/run_09fev21/fastq/all/
mv ~/runs/run_01mar21/fastq/all/SFJQ-neo-mi_S23_L001_R* ~/runs/run_01mar21/fastq/all/sfjq_dmx/
#samples iSeq Ecomol
cutadapt -j 79 --no-indels -g file:~/prjcts/fish_eDNA/sfjq/data/primers_neo_mi.fasta -G file:~/prjcts/fish_eDNA/sfjq/data/primers_neo_mi.fasta -o ~/runs/run_01mar21/fastq/all/sfjq_dmx/Da23-{name1}-{name2}_R1_001.fastq.gz -p ~/runs/run_01mar21/fastq/all/sfjq_dmx/Da23-{name1}-{name2}_R2_001.fastq.gz ~/runs/run_01mar21/fastq/all/Da23_S72_L001_R1_001.fastq ~/runs/run_01mar21/fastq/all/Da23_S72_L001_R2_001.fastq 2> ~/runs/run_01mar21/fastq/all/sfjq_dmx/cut_SFJQ_demux.txt
cp ~/runs/run_01mar21/fastq/all/sfjq_dmx/Da23-neo_FWD-neo_REV.* ~/runs/run_01mar21/fastq/all/
cp ~/runs/run_01mar21/fastq/all/sfjq_dmx/Da23-mif_FWD-mif_REV.* ~/runs/run_01mar21/fastq/all/
mv ~/runs/run_01mar21/fastq/all/Da23_S72_L001_R* ~/runs/run_01mar21/fastq/all/sfjq_dmx/Set path to raw data
#1 - load runs raw data ----
## All libs are demultiplexed
{
# PATH to the directory containing raw fastq files after unzipping.
libs_path1 <- "~/runs/run_29jul20/fastq/all"
libs_path2 <- "~/runs/run_09fev21/fastq/all"
libs_path3 <- "~/runs/run_01mar21/fastq/all"
}
#check content
list.files(path = libs_path1,pattern = "fastq")
list.files(path = libs_path2,pattern = "fastq")
list.files(path = libs_path3,pattern = "fastq") Identify sample names radicals
#2 - get sample names ----
# Forward and reverse fastq filenames have format: SAMPLENAME_R1_001.fastq and SAMPLENAME_R2_001.fastq
{
all_fnFs1 <- sort(list.files(libs_path1, pattern="_R1_001.fastq", full.names = TRUE))
all_fnRs1 <- sort(list.files(libs_path1, pattern="_R2_001.fastq", full.names = TRUE))
all_fnFs2 <- sort(list.files(libs_path2, pattern="_R1_001.fastq", full.names = TRUE))
all_fnRs2 <- sort(list.files(libs_path2, pattern="_R2_001.fastq", full.names = TRUE))
all_fnFs3 <- sort(list.files(libs_path3, pattern="_R1_001.fastq", full.names = TRUE))
all_fnRs3 <- sort(list.files(libs_path3, pattern="_R2_001.fastq", full.names = TRUE))
all_fnFs <- c(all_fnFs1,all_fnFs2,all_fnFs3)
all_fnRs <- c(all_fnRs1,all_fnRs2,all_fnRs3)
}
#load csv with primers and respective samples
primers_n_samples <- read.csv(file = "~/prjcts/fish_eDNA/sfjq/data/primers_n_samples_sfjq.csv",
header = TRUE)
#3 - map sample names to reads files ----
primers_n_samples <- primers_n_samples %>%
mutate("R1" = "R1",
"R2" = "R2")
for (sample in 1:nrow(primers_n_samples)) {
primers_n_samples$R1[sample] <-
all_fnFs[grep(pattern = paste0("/",primers_n_samples$File_name[sample]),x = all_fnFs)]
primers_n_samples$R2[sample] <-
all_fnRs[grep(pattern = paste0("/",primers_n_samples$File_name[sample]),x = all_fnRs)]
}Define sample levels
#4 - set sample levels
primers_n_samples$File_name
sample_levels <- c(
"Da23-mif", "SFJQ-mif",
"Da23-neo", "SFJQ-neo",
"Da20","SFnNorm-mi",
"Da19","SFnNorm-neo",
"Da22","SFNorm-mi",
"Da21","SFNorm-neo",
"pJequei-N-norm-N","pJequei-N-norm-M","pJequei-N-norm-T",
"pJequei-norm-N","pJequei-norm-M","pJequei-norm-T",
"Cassaum","neg-PCR2")
primer_levels <- c("NeoFish", "MiFish", "Teleo","NeoFish/MiFish", "NeoFish/MiFish/Teleo")
### Remove primers from reads
As the primer-derived sequences are identical, they are not informative and thus must be removed for the following steps.
Load primer sequences
#4- identify primers ----
#primers sequences used for each sample
# inosine pairs with A, C, U
# T, G, A = IUPAC code: D
#cutadapt accepts IUPAC code !!!!!!!!
{
#neo
neo_FWD <- "CGCCGTCGCAAGCTTACCCT"
names(neo_FWD) <- "neo_FWD"
neo_REV <- "AGTGACGGGCGGTGTGTGC"
names(neo_REV) <- "neo_REV"
#mif
mif_FWD <- "GTCGGTAAAACTCGTGCCAGC"
names(mif_FWD) <- "mif_FWD"
mif_REV <- "ACATAGTGGGGTATCTAATCCCAGTTTG"
# mif_REV <- "CATAGTGGGGTATCTAATCCCAGTTTG" #original
names(mif_REV) <- "mif_REV"
#tel
tel_FWD <- "ACACCGCCCGTCACTCT"
names(tel_FWD) <- "tel_FWD"
tel_REV <- "ACTTCCGGTACACTTACCATG"
names(tel_REV) <- "tel_REV"
#creates a list of single row tibbles for each primer
primers <- tibble(Primers = c(neo_FWD,neo_REV,
mif_FWD,mif_REV,
tel_FWD,tel_REV)) %>%
mutate(`Primer names`= names(Primers)) %>%
split(1:nrow(.))
}Generate sequences for complement, reverse, and reverse complement for each primer
The function allOrients is used to generate all possible orientations for primers FWD e REV.
#5 - check primer orientation ----
#function to get all possible primer orientations
allOrients <- function(primers) {
# Create all orientations of the input sequence
# Must be a tibble with cols = c(Primers,`Primer names`)
require(Biostrings)
dna <- Biostrings::DNAString(primers$Primers) # The Biostrings works w/ DNAString objects rather than character vectors
orients <- c(Forward = dna,
Complement = Biostrings::complement(dna),
Reverse = Biostrings::reverse(dna),
RevComp = Biostrings::reverseComplement(dna))
names(orients) <- paste0(names(orients))
primer_tbl <- sapply(orients, toString)
primer_tbl <- dplyr::tibble(Sequence = primer_tbl,
`Primer orientation` = names(primer_tbl)) %>%
dplyr::mutate(Primer = primers$`Primer names`) %>%
unite(col=`Orientation name`, Primer ,`Primer orientation`,remove = FALSE)
return(primer_tbl) # Convert back to character vector
}
#apply function
primers_all_orients <- purrr::map_dfr(primers, allOrients)
names(primers_all_orients$Sequence) <- primers_all_orients$`Orientation name`Remove reads with undetermined bases (Ns) and unpaired
Reads with undetermined bases prevent proper primer identification and ASV determination. These sequences must be removed from the data.
#6 - pre filter reads with Ns for primer checking ----
# create names for N-cleaned files
primers_n_samples <- primers_n_samples %>%
mutate("R1 N-cleaned" = "R1 N-cleaned",
"R2 N-cleaned" = "R2 N-cleaned")
for (sample in 1:nrow(primers_n_samples)) {
primers_n_samples$`R1 N-cleaned`[sample] <-
paste0(data_path,"/N-cleaned/",primers_n_samples$File_name[sample],"_R1_N-cleaned.fastq.gz")
primers_n_samples$`R2 N-cleaned`[sample] <-
paste0(data_path,"/N-cleaned/",primers_n_samples$File_name[sample],"_R2_N-cleaned.fastq.gz")
}
# remove reads with Ns to make primer filtering more accurate
dada2::filterAndTrim(
fwd = primers_n_samples$R1, filt = primers_n_samples$`R1 N-cleaned`,
rev = primers_n_samples$R2, filt.rev = primers_n_samples$`R2 N-cleaned`,
maxN = 0, multithread = TRUE, matchIDs = TRUE,
verbose = TRUE, compress = TRUE)
# pivote table to longer format
primers_n_samples <- primers_n_samples %>%
pivot_longer(cols = c(R1,R2,`R1 N-cleaned`,`R2 N-cleaned`),
names_to = "Stage", values_to = "Read file")Count primer presence on reads
Before primer removal it is possible to count their presence on the reads. This procedures is carried on independently for each sample.
#6 - count primer orientation hits ----
#function to count primer on each specific library
primerHits <- function(primer, fn) {
# Counts number of reads in which the primer is found
nhits <- Biostrings::vcountPattern(primer, ShortRead::sread(ShortRead::readFastq(fn)), fixed = FALSE)
return(sum(nhits > 0))
}
#function to call primerHits for multiple primers
multi_primerHits <- function(Read_file,primers){
primer_counts <- purrr::map_df(primers,.f = primerHits, fn = Read_file)
primer_counts <- primer_counts %>% mutate(`Read file` = Read_file)
return(primer_counts)
}
###########
#vector of read files to look on for primers
reads_seqs <- primers_n_samples %>%
filter(Stage %in% c("R1 N-cleaned", "R2 N-cleaned")) %>%
select(`Read file`) %>% as.list()
#named vector of primer sequences
primers_seqs <- primers_all_orients$Sequence
cores_to_be_used <- future::availableCores() - 2 # Usar todos os cores -2 = 78
future::plan(future::multisession(workers = cores_to_be_used))
#count primers
primers_in_Nreads <- furrr::future_map_dfr(reads_seqs$`Read file`, .f = multi_primerHits, primers = primers_seqs, .options = furrr::furrr_options(seed = NULL))
#get sample information into primers_in_Nreads table
primers_in_Nreads <- left_join(primers_in_Nreads,primers_n_samples,by = "Read file")
#
# primers_in_Nreads_bckp <- primers_in_Nreads
# primers_in_Nreads <- primers_in_Nreads_bckpPrepare primer counts for ploting
#7- prepare primer counts for plots ----
# cat(paste0(colnames(primers_in_Nreads),"\n"))
primers_in_Nreads <-
primers_in_Nreads %>%
select(# `Read file
File_name, Type, Group, Library, Primer, Run, Stage,
neo_FWD_Forward, neo_REV_Forward, neo_FWD_Complement, neo_REV_Complement,
neo_FWD_Reverse, neo_REV_Reverse, neo_FWD_RevComp, neo_REV_RevComp,
mif_FWD_Forward, mif_REV_Forward, mif_FWD_Complement, mif_REV_Complement,
mif_FWD_Reverse, mif_REV_Reverse, mif_FWD_RevComp, mif_REV_RevComp,
tel_FWD_Forward, tel_REV_Forward, tel_FWD_Complement, tel_REV_Complement,
tel_FWD_Reverse, tel_REV_Reverse, tel_FWD_RevComp, tel_REV_RevComp)
#write.csv(x = primer_hits_tbl, file = "~/prjcts/fish_eDNA/notes/jequiDNApool/csv/primers_hits_in_reads.csv")
str(primers_in_Nreads)
colnames(primers_in_Nreads)
rownames(primers_in_Nreads)
primers_in_Nreads$Primer
primers_in_Nreads$Library
#8- prepare primer counts for plots in ggplot----
#convert primer hits table to long format
primers_in_Nreads_long <- primers_in_Nreads %>%
gather(key = Sequences,
value = Count,
neo_FWD_Forward, neo_FWD_Complement, neo_FWD_Reverse,neo_FWD_RevComp,
neo_REV_Forward, neo_REV_Complement, neo_REV_Reverse, neo_REV_RevComp,
mif_FWD_Forward, mif_FWD_Complement, mif_FWD_Reverse, mif_FWD_RevComp,
mif_REV_Forward, mif_REV_Complement, mif_REV_Reverse, mif_REV_RevComp,
tel_FWD_Forward, tel_FWD_Complement, tel_FWD_Reverse, tel_FWD_RevComp,
tel_REV_Forward, tel_REV_Complement, tel_REV_Reverse, tel_REV_RevComp
) %>%
mutate(Sequences = factor(Sequences,
levels = c("neo_FWD_Forward","neo_FWD_RevComp",
"neo_REV_Forward","neo_REV_RevComp",
"neo_FWD_Complement","neo_FWD_Reverse",
"neo_REV_Complement","neo_REV_Reverse",
"mif_FWD_Forward","mif_FWD_RevComp",
"mif_REV_Forward","mif_REV_RevComp",
"mif_FWD_Complement","mif_FWD_Reverse",
"mif_REV_Complement","mif_REV_Reverse",
"tel_FWD_Forward","tel_FWD_RevComp",
"tel_REV_Forward","tel_REV_RevComp",
"tel_FWD_Complement","tel_FWD_Reverse",
"tel_REV_Complement","tel_REV_Reverse")),
File_name = factor(File_name,levels = sample_levels),
Run = as.factor(Run),
Primer = factor(Primer,levels = c("NeoFish",
"MiFish",
"Teleo",
"NeoFish/MiFish",
"NeoFish/MiFish/Teleo")))
# PLOT 1: primers counts in reads tile plot - only primers FWD & REV, foward & revcomp ----
primers_tile <-
primers_in_Nreads_long %>%
# filter(Sequences %in% c(
# "mif_REV_RevComp", "mif_REV_Forward", "mif_FWD_RevComp", "mif_FWD_Forward",
# "neo_REV_RevComp", "neo_REV_Forward", "neo_FWD_RevComp", "neo_FWD_Forward",
# "tel_REV_RevComp", "tel_REV_Forward", "tel_FWD_RevComp", "tel_FWD_Forward")) %>%
mutate(File_name = factor(File_name,levels = sample_levels)) %>%
ggplot2::ggplot(aes(y=File_name,x=Sequences,fill=log10(Count)
# ,col=Stage
)) +
geom_tile()+
geom_text(aes(label = Count),size=1)+
# scale_fill_gradient(low="white", high="darkgreen",trans="log10") +
scale_fill_gradientn(name = "Primer counts",
colours = c("white","darkgreen"),
values = c(0,1),
na.value ="white") +
theme_light(base_line_size = 1,base_size = 6) +
theme(axis.text.x = element_text(angle = 45,hjust = 1)) +
geom_hline(yintercept = c(40.5,82.5,86.5,116.5),color = "grey") +
geom_vline(xintercept = c(4.5,8.5,12.5,16.5),color = "grey") +
# coord_fixed(ratio = 0.20) +
xlab("Primers") +
ylab("Amostra") +
ggtitle(label = "eDNA 1st, 2nd & 3rd runs",
subtitle = "Primer presence on sample reads")
primers_tile
ggsave(file = "~/prjcts/fish_eDNA/sfjq/results/figs/1-primers_in_reads_all_FR.png",
plot = primers_tile,
device = "png",
width = 27,
height = 40,
units = "cm",
dpi = 600)
ggsave(file = "~/prjcts/fish_eDNA/sfjq/results/figs/1-primers_in_reads_all_FR.pdf",
plot = primers_tile,
device = "pdf",
width = 27,
height = 40,
units = "cm",
dpi = 600)
#9- write csv file with primer hits counts per lib ----
write.csv(x = primer_hits_tbl,file = "~/prjcts/fish_eDNA/sfjq/results/primers_hits_tbl.csv",
row.names = FALSE)Remove primers from reads
Primer removal with Cutadapt
The cutadapt software (DOI:10.14806/ej.17.1.200) was used for primer removal on read sequences.
#10 - cutadapt ----
#set or create cutadapt processed reads dir path
path.cut <- file.path(data_path, "cutadapt")
if(!dir.exists(path.cut)) dir.create(path.cut)Generate and execute primer-specific commands
The original DADA2 ITS protocol removes only FWD and REV reverse complement sequences. This protocol is adjusted for selecting reads only of the expected primer and removing the primer.
# opitional: remove all primers from all reads and samples ----
#10 - map sample names to reads files ----
#name outputs
cutadapt_files <- primers_n_samples %>%
filter(Stage %in% c("R1 N-cleaned","R2 N-cleaned")) %>%
mutate(`Read file` = str_replace_all(.$`Read file`,pattern = "N-cleaned",replacement = "cutadapt")) %>%
mutate(Stage = str_replace_all(.$Stage,pattern = "N-cleaned",replacement = "cutadapt"))
primers_n_samples <- bind_rows(primers_n_samples,cutadapt_files)
#all ----
{
#make reverse complements
# the XXX_Complement and XXX_reverse have no hits so were ignored at last plot and from now on
all_FWD.orients <- primers_all_orients$Sequence[primers_all_orients$`Orientation name` %>% grep(pattern = c("FWD_Forward"))]
all_FWD.RC <- primers_all_orients$Sequence[primers_all_orients$`Orientation name` %>% grep(pattern = c("FWD_RevComp"))]
all_REV.orients <- primers_all_orients$Sequence[primers_all_orients$`Orientation name` %>% grep(pattern = c("REV_Forward"))]
all_REV.RC <- primers_all_orients$Sequence[primers_all_orients$`Orientation name` %>% grep(pattern = c("REV_RevComp"))]
}
#remove primers and filter only the reads that contain the expected primer ----
{
#MiFish ----
mif_FWD.orients <- primers_all_orients$Sequence[primers_all_orients$`Orientation name` %>% grep(pattern = c("mif_FWD_Forward"))]
mif_FWD.RC <- primers_all_orients$Sequence[primers_all_orients$`Orientation name` %>% grep(pattern = c("mif_FWD_RevComp"))]
mif_REV.orients <- primers_all_orients$Sequence[primers_all_orients$`Orientation name` %>% grep(pattern = c("mif_REV_Forward"))]
mif_REV.RC <- primers_all_orients$Sequence[primers_all_orients$`Orientation name` %>% grep(pattern = c("mif_REV_RevComp"))]
#NeoFish ----
neo_FWD.orients <- primers_all_orients$Sequence[primers_all_orients$`Orientation name` %>% grep(pattern = c("neo_FWD_Forward"))]
neo_FWD.RC <- primers_all_orients$Sequence[primers_all_orients$`Orientation name` %>% grep(pattern = c("neo_FWD_RevComp"))]
neo_REV.orients <- primers_all_orients$Sequence[primers_all_orients$`Orientation name` %>% grep(pattern = c("neo_REV_Forward"))]
neo_REV.RC <- primers_all_orients$Sequence[primers_all_orients$`Orientation name` %>% grep(pattern = c("neo_REV_RevComp"))]
#Teleo ----
tel_FWD.orients <- primers_all_orients$Sequence[primers_all_orients$`Orientation name` %>% grep(pattern = c("tel_FWD_Forward"))]
tel_FWD.RC <- primers_all_orients$Sequence[primers_all_orients$`Orientation name` %>% grep(pattern = c("tel_FWD_RevComp"))]
tel_REV.orients <- primers_all_orients$Sequence[primers_all_orients$`Orientation name` %>% grep(pattern = c("tel_REV_Forward"))]
tel_REV.RC <- primers_all_orients$Sequence[primers_all_orients$`Orientation name` %>% grep(pattern = c("tel_REV_RevComp"))]
}
#creat flags
# Trim FWD and the reverse-complement of REV off of R1 (forward reads)
all_R1.flags <- paste("-g", all_FWD.orients, "-a", all_REV.RC)
# Trim REV and the reverse-complement of FWD off of R2 (reverse reads)
all_R2.flags <- paste("-G", all_REV.orients, "-A", all_FWD.RC)
#create primer-specific tags ----
{
#MiFish ----
# Trim FWD and the reverse-complement of REV off of R1 (forward reads)
mif_R1.flags <- paste("-g", mif_FWD.orients, "-a", mif_REV.RC)
# Trim REV and the reverse-complement of FWD off of R2 (reverse reads)
mif_R2.flags <- paste("-G", mif_REV.orients, "-A", mif_FWD.RC)
#NeoFish ----
# Trim FWD and the reverse-complement of REV off of R1 (forward reads)
neo_R1.flags <- paste("-g", neo_FWD.orients, "-a", neo_REV.RC)
# Trim REV and the reverse-complement of FWD off of R2 (reverse reads)
neo_R2.flags <- paste("-G", neo_REV.orients, "-A", neo_FWD.RC)
#Teleo ----
# Trim FWD and the reverse-complement of REV off of R1 (forward reads)
tel_R1.flags <- paste("-g", tel_FWD.orients, "-a", tel_REV.RC)
# Trim REV and the reverse-complement of FWD off of R2 (reverse reads)
tel_R2.flags <- paste("-G", tel_REV.orients, "-A", tel_FWD.RC)
}
#cutadapt files path and names ----
{
all_fnFs.cut <- primers_n_samples$`Read file`[primers_n_samples$Stage == "R1 cutadapt"]
names(all_fnFs.cut) <- all_fnFs.cut %>%
str_remove(pattern = paste0("~/prjcts/fish_eDNA/sfjq/data/reads/cutadapt/")) %>%
str_remove(pattern = "_cutadapt.fastq.gz")
all_fnRs.cut <- primers_n_samples$`Read file`[primers_n_samples$Stage == "R2 cutadapt"]
names(all_fnRs.cut) <- all_fnRs.cut %>%
str_remove(pattern = paste0("~/prjcts/fish_eDNA/sfjq/data/reads/cutadapt/")) %>%
str_remove(pattern = "_cutadapt.fastq.gz")
all_fnFs.filtN <- primers_n_samples$`Read file`[primers_n_samples$Stage == "R1 N-cleaned"]
all_fnRs.filtN <- primers_n_samples$`Read file`[primers_n_samples$Stage == "R2 N-cleaned"]
}
{
#neo ----
neo_fnFs.cut <- primers_n_samples$`Read file`[primers_n_samples$Stage == "R1 cutadapt" & primers_n_samples$Primer == "NeoFish"]
names(neo_fnFs.cut) <- neo_fnFs.cut %>%
str_remove(pattern = paste0("~/prjcts/fish_eDNA/sfjq/data/reads/cutadapt/")) %>%
str_remove(pattern = "_cutadapt.fastq.gz")
neo_fnRs.cut <- primers_n_samples$`Read file`[primers_n_samples$Stage == "R2 cutadapt" & primers_n_samples$Primer == "NeoFish"]
names(neo_fnRs.cut) <- neo_fnRs.cut %>%
str_remove(pattern = paste0("~/prjcts/fish_eDNA/sfjq/data/reads/cutadapt/")) %>%
str_remove(pattern = "_cutadapt.fastq.gz")
neo_fnFs.filtN <- primers_n_samples$`Read file`[primers_n_samples$Stage == "R1 N-cleaned" & primers_n_samples$Primer == "NeoFish"]
names(neo_fnFs.filtN) <- neo_fnFs.filtN %>%
str_remove(pattern = paste0("~/prjcts/fish_eDNA/sfjq/data/reads/N-cleaned/")) %>%
str_remove(pattern = "_N-cleaned.fastq.gz")
neo_fnRs.filtN <- primers_n_samples$`Read file`[primers_n_samples$Stage == "R2 N-cleaned" & primers_n_samples$Primer == "NeoFish"]
names(neo_fnRs.filtN) <- neo_fnRs.filtN %>%
str_remove(pattern = paste0("~/prjcts/fish_eDNA/sfjq/data/reads/N-cleaned/")) %>%
str_remove(pattern = "_N-cleaned.fastq.gz")
#mif ----
mif_fnFs.cut <- primers_n_samples$`Read file`[primers_n_samples$Stage == "R1 cutadapt" & primers_n_samples$Primer == "MiFish"]
names(mif_fnFs.cut) <- mif_fnFs.cut %>%
str_remove(pattern = paste0("~/prjcts/fish_eDNA/sfjq/data/reads/cutadapt/")) %>%
str_remove(pattern = "_cutadapt.fastq.gz")
mif_fnRs.cut <- primers_n_samples$`Read file`[primers_n_samples$Stage == "R2 cutadapt" & primers_n_samples$Primer == "MiFish"]
names(mif_fnRs.cut) <- mif_fnRs.cut %>%
str_remove(pattern = paste0("~/prjcts/fish_eDNA/sfjq/data/reads/cutadapt/")) %>%
str_remove(pattern = "_cutadapt.fastq.gz")
mif_fnFs.filtN <- primers_n_samples$`Read file`[primers_n_samples$Stage == "R1 N-cleaned" & primers_n_samples$Primer == "MiFish"]
names(mif_fnFs.filtN) <- mif_fnFs.filtN %>%
str_remove(pattern = paste0("~/prjcts/fish_eDNA/sfjq/data/reads/N-cleaned/")) %>%
str_remove(pattern = "_N-cleaned.fastq.gz")
mif_fnRs.filtN <- primers_n_samples$`Read file`[primers_n_samples$Stage == "R2 N-cleaned" & primers_n_samples$Primer == "MiFish"]
names(mif_fnRs.filtN) <- mif_fnRs.filtN %>%
str_remove(pattern = paste0("~/prjcts/fish_eDNA/sfjq/data/reads/N-cleaned/")) %>%
str_remove(pattern = "_N-cleaned.fastq.gz")
#tel ----
tel_fnFs.cut <- primers_n_samples$`Read file`[primers_n_samples$Stage == "R1 cutadapt" & primers_n_samples$Primer == "Teleo"]
names(tel_fnFs.cut) <- tel_fnFs.cut %>%
str_remove(pattern = paste0("~/prjcts/fish_eDNA/sfjq/data/reads/cutadapt/")) %>%
str_remove(pattern = "_cutadapt.fastq.gz")
tel_fnRs.cut <- primers_n_samples$`Read file`[primers_n_samples$Stage == "R2 cutadapt" & primers_n_samples$Primer == "Teleo"]
names(tel_fnRs.cut) <- tel_fnRs.cut %>%
str_remove(pattern = paste0("~/prjcts/fish_eDNA/sfjq/data/reads/cutadapt/")) %>%
str_remove(pattern = "_cutadapt.fastq.gz")
tel_fnFs.filtN <- primers_n_samples$`Read file`[primers_n_samples$Stage == "R1 N-cleaned" & primers_n_samples$Primer == "Teleo"]
names(tel_fnFs.filtN) <- tel_fnFs.filtN %>%
str_remove(pattern = paste0("~/prjcts/fish_eDNA/sfjq/data/reads/N-cleaned/")) %>%
str_remove(pattern = "_N-cleaned.fastq.gz")
tel_fnRs.filtN <- primers_n_samples$`Read file`[primers_n_samples$Stage == "R2 N-cleaned" & primers_n_samples$Primer == "Teleo"]
names(tel_fnRs.filtN) <- tel_fnRs.filtN %>%
str_remove(pattern = paste0("~/prjcts/fish_eDNA/sfjq/data/reads/N-cleaned/")) %>%
str_remove(pattern = "_N-cleaned.fastq.gz")
#neo/mif & neo/mif/tel ----
nmt_fnFs.cut <- primers_n_samples$`Read file`[primers_n_samples$Stage == "R1 cutadapt" & primers_n_samples$Primer %in% c("NeoFish/MiFish","NeoFish/MiFish/Teleo")]
names(nmt_fnFs.cut) <- nmt_fnFs.cut %>%
str_remove(pattern = paste0("~/prjcts/fish_eDNA/sfjq/data/reads/cutadapt/")) %>%
str_remove(pattern = "_cutadapt.fastq.gz")
nmt_fnRs.cut <- primers_n_samples$`Read file`[primers_n_samples$Stage == "R2 cutadapt" & primers_n_samples$Primer %in% c("NeoFish/MiFish","NeoFish/MiFish/Teleo")]
names(nmt_fnRs.cut) <- nmt_fnRs.cut %>%
str_remove(pattern = paste0("~/prjcts/fish_eDNA/sfjq/data/reads/cutadapt/")) %>%
str_remove(pattern = "_cutadapt.fastq.gz")
nmt_fnFs.filtN <- primers_n_samples$`Read file`[primers_n_samples$Stage == "R1 N-cleaned" & primers_n_samples$Primer %in% c("NeoFish/MiFish","NeoFish/MiFish/Teleo")]
names(nmt_fnFs.filtN) <- nmt_fnFs.filtN %>%
str_remove(pattern = paste0("~/prjcts/fish_eDNA/sfjq/data/reads/N-cleaned/")) %>%
str_remove(pattern = "_N-cleaned.fastq.gz")
nmt_fnRs.filtN <- primers_n_samples$`Read file`[primers_n_samples$Stage == "R2 N-cleaned" & primers_n_samples$Primer %in% c("NeoFish/MiFish","NeoFish/MiFish/Teleo")]
names(nmt_fnRs.filtN) <- nmt_fnRs.filtN %>%
str_remove(pattern = paste0("~/prjcts/fish_eDNA/sfjq/data/reads/N-cleaned/")) %>%
str_remove(pattern = "_N-cleaned.fastq.gz")
}
# e essa ordem tá perigosa
names(primers_n_samples$`Read file`)<- primers_n_samples$File_name
primers_n_samples$`Read file`[primers_n_samples$Stage %in% c("R1 N-cleaned", "R2 N-cleaned")] %>% length()
#TODO esse tem q ir pro purrr...
# Run Cutadapt
# output folder must exist
for(i in 1:40) {
# for(i in seq_along(all_fnFs)) {
system2(cutadapt, args = c(all_R1.flags, all_R2.flags, "-n", 2, # -n 2 required to remove FWD and REV from reads
"-o", all_fnFs.cut[i], "-p", all_fnRs.cut[i], # output files
all_fnFs.filtN[i], all_fnRs.filtN[i], # input files
"--minimum-length 10")) # guarantee no zerolength reads
}
length(neo_fnFs.cut)
length(mif_fnFs.cut)
length(mif_fnRs.cut)
length(tel_fnFs.cut)
length(nmt_fnFs.cut)
#run cutadapt by primer ----
#MiFish ----
for(i in 1:length(mif_fnFs.cut)) {
# for(i in seq_along(all_fnFs)) {
system2(cutadapt, args = c(mif_R1.flags, mif_R2.flags, "-n", 2, # -n 2 required to remove FWD and REV from reads
"-o", mif_fnFs.cut[i], "-p", mif_fnRs.cut[i], # output files
mif_fnFs.filtN[i], mif_fnRs.filtN[i], # input files
"--minimum-length 10 --discard-untrimmed")) # guarantee no zerolength reads
}
#NeoFish ----
for(i in 1:length(neo_fnFs.cut)) {
# for(i in seq_along(all_fnFs)) {
system2(cutadapt, args = c(neo_R1.flags, neo_R2.flags, "-n", 2, # -n 2 required to remove FWD and REV from reads
"-o", neo_fnFs.cut[i], "-p", neo_fnRs.cut[i], # output files
neo_fnFs.filtN[i], neo_fnRs.filtN[i], # input files
"--minimum-length 10 --discard-untrimmed")) # guarantee no zerolength reads
}
#Teleo ----
for(i in 1:length(tel_fnFs.cut)) {
# for(i in seq_along(all_fnFs)) {
system2(cutadapt, args = c(tel_R1.flags, tel_R2.flags, "-n", 2, # -n 2 required to remove FWD and REV from reads
"-o", tel_fnFs.cut[i], "-p", tel_fnRs.cut[i], # output files
tel_fnFs.filtN[i], tel_fnRs.filtN[i], # input files
"--minimum-length 10 --discard-untrimmed")) # guarantee no zerolength reads
}
#neo/mif & neo/mif/tel ----
for(i in 1:length(nmt_fnFs.cut)) {
# for(i in seq_along(all_fnFs)) {
system2(cutadapt, args = c(all_R1.flags, all_R2.flags, "-n", 2, # -n 2 required to remove FWD and REV from reads
"-o", nmt_fnFs.cut[i], "-p", nmt_fnRs.cut[i], # output files
nmt_fnFs.filtN[i], nmt_fnRs.filtN[i], # input files
"--minimum-length 10 --discard-untrimmed")) # guarantee no zerolength reads
}
# as Da23-mif & neo & SFJQ-mif & neo were previously demultiplexed, they do not bear the primers, so all reads are filtered outCheck primer removal
Change de library number index in order to check the presence of remaining primer sequences on each lib data. It is expected that all removed orientation counts change to zero since the primer sequences are removed.
# only ofr didatic purposes (or logical error checking)
# 8 - check for remaining adapters ----
# As a sanity check, we will count the presence of primers in the first cutadapt-ed sample:
#vector of read files to look on for primers
reads_seqs_cut <- primers_n_samples %>%
filter(Stage %in% c("R2 cutadapt", "R2 cutadapt")) %>%
select(`Read file`) %>% as.list()
#count primers
future::plan(future::multisession(workers = cores_to_be_used))
primers_in_cut_reads <- furrr::future_map_dfr(reads_seqs_cut$`Read file`, .f = multi_primerHits, primers = primers_seqs, .options = furrr::furrr_options(seed = NULL))
#
# primers_in_Nreads <- purrr::map_df(reads_seqs,.f = multi_primerHits, primers = primers_seqs)
#get sample information into primers_in_Nreads table
primers_in_cut_reads <- left_join(primers_in_cut_reads,primers_n_samples,by = "Read file")
# primers_in_cut_reads_bckp <- primers_in_cut_reads
# primers_in_cut_reads <- primers_in_cut_reads_bckp
primers_in_cut_reads <-
primers_in_cut_reads %>%
select(# `Read file
File_name, Type, Group, Library, Primer, Run, Stage,
neo_FWD_Forward, neo_REV_Forward, neo_FWD_Complement, neo_REV_Complement,
neo_FWD_Reverse, neo_REV_Reverse, neo_FWD_RevComp, neo_REV_RevComp,
mif_FWD_Forward, mif_REV_Forward, mif_FWD_Complement, mif_REV_Complement,
mif_FWD_Reverse, mif_REV_Reverse, mif_FWD_RevComp, mif_REV_RevComp,
tel_FWD_Forward, tel_REV_Forward, tel_FWD_Complement, tel_REV_Complement,
tel_FWD_Reverse, tel_REV_Reverse, tel_FWD_RevComp, tel_REV_RevComp)
#convert primer hits table to long format
primers_in_cut_reads_long <- primers_in_cut_reads %>%
gather(key = Sequences,
value = Count,
neo_FWD_Forward, neo_FWD_Complement,
neo_FWD_Reverse,neo_FWD_RevComp,
neo_REV_Forward, neo_REV_Complement,
neo_REV_Reverse, neo_REV_RevComp,
mif_FWD_Forward, mif_FWD_Complement,
mif_FWD_Reverse, mif_FWD_RevComp,
mif_REV_Forward, mif_REV_Complement,
mif_REV_Reverse, mif_REV_RevComp,
tel_FWD_Forward, tel_FWD_Complement,
tel_FWD_Reverse, tel_FWD_RevComp,
tel_REV_Forward, tel_REV_Complement,
tel_REV_Reverse, tel_REV_RevComp) %>%
mutate(Sequences = factor(Sequences,levels = c("neo_FWD_Forward", "neo_REV_Forward",
"neo_FWD_RevComp", "neo_REV_RevComp",
"neo_FWD_Complement", "neo_REV_Complement",
"neo_FWD_Reverse", "neo_REV_Reverse",
"mif_FWD_Forward", "mif_REV_Forward",
"mif_FWD_RevComp", "mif_REV_RevComp",
"mif_FWD_Complement", "mif_REV_Complement",
"mif_FWD_Reverse", "mif_REV_Reverse",
"tel_FWD_Forward", "tel_REV_Forward",
"tel_FWD_RevComp", "tel_REV_RevComp",
"tel_FWD_Complement", "tel_REV_Complement",
"tel_FWD_Reverse", "tel_REV_Reverse")),
File_name = factor(File_name,levels = sample_levels),
Run = as.factor(Run),
Primer = factor(Primer,levels = c("NeoFish","MiFish","Teleo","NeoFish/MiFish","NeoFish/MiFish/Teleo")))
# PLOT 1: primers counts in reads tile plot - only primers FWD & REV, foward & revcomp ----
primers_tile_clean <-
primers_in_cut_reads_long %>%
filter(Sequences %in% c(
"mif_REV_RevComp", "mif_REV_Forward", "mif_FWD_RevComp", "mif_FWD_Forward",
"neo_REV_RevComp", "neo_REV_Forward", "neo_FWD_RevComp", "neo_FWD_Forward",
"tel_REV_RevComp", "tel_REV_Forward", "tel_FWD_RevComp", "tel_FWD_Forward")) %>%
filter(Run %in% c("LGC_MiniSeq_1")) %>%
ggplot2::ggplot(aes(y=File_name,x=Sequences,fill=log10(Count))) +
geom_tile()+
geom_text(aes(label = Count),size=1)+
# scale_fill_gradient(low="white", high="darkgreen",trans="log10") +
scale_fill_gradientn(name = "Primer counts",
colours = c("white","darkgreen"),
values = c(0,1),
na.value ="white") +
theme_light(base_line_size = 1,base_size = 6) +
theme(axis.text.x = element_text(angle = 45,hjust = 1)) +
geom_hline(yintercept = c(40.5,82.5,86.5,116.5),color = "grey") +
geom_vline(xintercept = c(4.5,8.5,12.5,16.5),color = "grey") +
# coord_fixed(ratio = 0.20) +
xlab("Primers") +
ylab("Amostra") +
ggtitle(label = "eDNA 1st, 2nd & 3rd runs",
subtitle = "Primer presence on sample reads")
# +
# facet_wrap(~Run, drop = TRUE)
primers_tile_cleanQuality filtering
Here the DADA2 pipeline starts.
Set input libs paths
Define the paths to the libraries after cutadapt primer removal.
# 9 - load clean seqs to DADA2 pipe ----
all_fnFs.cut <- c(mif_fnFs.cut,neo_fnFs.cut,tel_fnFs.cut,nmt_fnFs.cut)
all_fnRs.cut <- c(mif_fnRs.cut,neo_fnRs.cut,tel_fnRs.cut,nmt_fnRs.cut)
all_fnFs.cut
all_fnRs.cutSet quality filtering output files names
# 11 - quality filter preparation ----
#name outputs
Qfilter_files <- primers_n_samples %>%
filter(Stage %in% c("R1 N-cleaned","R2 N-cleaned")) %>%
mutate(`Read file` = str_replace_all(.$`Read file`,pattern = "N-cleaned",replacement = "Qfiltered")) %>%
mutate(Stage = str_replace_all(.$Stage,pattern = "N-cleaned",replacement = "Qfiltered"))
primers_n_samples <- bind_rows(primers_n_samples,Qfilter_files)
#rename files so all can be traceble
names(primers_n_samples$`Read file`) <- primers_n_samples$File_name
# Qfiltered files path and names
all_filtFs <- primers_n_samples$`Read file`[primers_n_samples$Stage == "R1 Qfiltered"]
names(all_filtFs) <- all_filtFs %>%
str_remove(pattern = paste0(data_path,"/Qfiltered/")) %>%
str_remove(pattern = "_Qfiltered.fastq.gz")
all_filtRs <- primers_n_samples$`Read file`[primers_n_samples$Stage == "R2 Qfiltered"]
names(all_filtRs) <- all_filtRs %>%
str_remove(pattern = paste0(data_path,"/Qfiltered/")) %>%
str_remove(pattern = "_Qfiltered.fastq.gz")Quality filtering
On this step it is possible to filter by size but, as we have already removed primers from the beginning/end of the reads, it is expected that the remaining sequences are already trimmed to lengths compatible with their respective amplicons. Thus, no length trimming was conducted.
# 12 - dada filtering ----
# We’ll use standard filtering parameters: maxN=0 (DADA2 requires no Ns), truncQ=2, rm.phix=TRUE and maxEE=2. The maxEE parameter sets the maximum number of “expected errors” allowed in a read, which is a better filter than simply averaging quality scores.
length(all_fnFs.cut)
length(all_filtFs)
length(all_fnRs.cut)
length(all_filtRs)
#sorting for next step not to mix files
all_fnFs.cut <- base::sort(all_fnFs.cut)
all_filtFs <- base::sort(all_filtFs)
all_fnRs.cut <- base::sort(all_fnRs.cut)
all_filtRs <- base::sort(all_filtRs)
names(all_fnFs.cut)
names(all_filtFs)
names(all_fnRs.cut)
names(all_filtRs)
#all
all_filtered_out <- dada2::filterAndTrim(fwd = all_fnFs.cut,
filt = all_filtFs,
rev = all_fnRs.cut,
filt.rev = all_filtRs,
# truncLen=c(240,160),
maxN=0,
maxEE=c(2,2),
# truncQ=2,
rm.phix=TRUE,
compress=TRUE, multithread=TRUE,verbose = TRUE,matchIDs = TRUE) # On Windows set multithread=FALSE
head(all_filtered_out)View post-filtering quality profiles
#check quality profile after filtering and trimming
plotQualityProfile(all_filtFs[2])
plotQualityProfile(all_filtRs[2:8])
plotQualityProfile(mif_filtFs[])
plotQualityProfile(mif_filtRs[])Identify error rates intrinsic to sequencing
# 13 - learn error rates ----
#Learn the Error Rates
primers_n_samples$Run %>% unique()
#run LGC_MiniSeq_1 ----
run1_errF <- learnErrors(primers_n_samples$`Read file`[primers_n_samples$Run == "LGC_MiniSeq_1" &
primers_n_samples$Stage == "R1 Qfiltered"],
multithread=TRUE,randomize = TRUE)
run1_errR <- learnErrors(primers_n_samples$`Read file`[primers_n_samples$Run == "LGC_MiniSeq_1" &
primers_n_samples$Stage == "R2 Qfiltered"],
multithread=TRUE,randomize = TRUE)
#run LGC_MiniSeq_2 ----
run2_errF <- learnErrors(primers_n_samples$`Read file`[primers_n_samples$Run == "LGC_MiniSeq_2" &
primers_n_samples$Stage == "R1 Qfiltered"],
multithread=TRUE,randomize = TRUE)
run2_errR <- learnErrors(primers_n_samples$`Read file`[primers_n_samples$Run == "LGC_MiniSeq_2" &
primers_n_samples$Stage == "R2 Qfiltered"],
multithread=TRUE,randomize = TRUE)
#run ecomol_iSeq ----
run3_errF <- learnErrors(primers_n_samples$`Read file`[primers_n_samples$Run == "ecomol_iSeq" &
primers_n_samples$Stage == "R1 Qfiltered"],
multithread=TRUE,randomize = TRUE)
run3_errR <- learnErrors(primers_n_samples$`Read file`[primers_n_samples$Run == "ecomol_iSeq" &
primers_n_samples$Stage == "R2 Qfiltered"],
multithread=TRUE,randomize = TRUE)
# # plotErrors(run3_errF, nominalQ=TRUE)
# # plotErrors(run3_errR, nominalQ=TRUE)Dereplication: grouping into ASVs
On this step each library is reduced to its unique composing sequences and their counts.
# 14 - dada dereplication ----
names(primers_n_samples$`Read file`) <- primers_n_samples$File_name ###!!!!!!!!!!!!! Everything must have unique names from here
unique(primers_n_samples$`Read file`)
names(primers_n_samples$`Read file`)
#run LGC_MiniSeq_1 ----
LGC_1_derep_forward <- derepFastq(primers_n_samples$`Read file`[
primers_n_samples$Run == "LGC_MiniSeq_1" &
primers_n_samples$Stage == "R1 Qfiltered"], verbose=TRUE)
# names(all_derep_forward) <- all_sample.names
LGC_1_derep_reverse <- derepFastq(primers_n_samples$`Read file`[
primers_n_samples$Run == "LGC_MiniSeq_1" &
primers_n_samples$Stage == "R2 Qfiltered"], verbose=TRUE)
# names(all_derep_reverse) <- all_sample.names
LGC_1_dadaFs <- dada(LGC_1_derep_forward, err=run1_errF, multithread=TRUE)
LGC_1_dadaRs <- dada(LGC_1_derep_reverse, err=run1_errR, multithread=TRUE)
#run LGC_MiniSeq_2 ----
LGC_2_derep_forward <- derepFastq(primers_n_samples$`Read file`[
primers_n_samples$Run == "LGC_MiniSeq_2" &
primers_n_samples$Stage == "R1 Qfiltered"], verbose=TRUE)
# names(all_derep_forward) <- all_sample.names
LGC_2_derep_reverse <- derepFastq(primers_n_samples$`Read file`[
primers_n_samples$Run == "LGC_MiniSeq_2" &
primers_n_samples$Stage == "R2 Qfiltered"], verbose=TRUE)
# names(all_derep_reverse) <- all_sample.names
LGC_2_dadaFs <- dada(LGC_2_derep_forward, err=run2_errF, multithread=TRUE)
LGC_2_dadaRs <- dada(LGC_2_derep_reverse, err=run2_errR, multithread=TRUE)
#run ecomol_iSeq ----
ecomol_derep_forward <- derepFastq(primers_n_samples$`Read file`[
primers_n_samples$Run == "ecomol_iSeq" &
primers_n_samples$Stage == "R1 Qfiltered"], verbose=TRUE)
# names(all_derep_forward) <- all_sample.names
ecomol_derep_reverse <- derepFastq(primers_n_samples$`Read file`[
primers_n_samples$Run == "ecomol_iSeq" &
primers_n_samples$Stage == "R2 Qfiltered"], verbose=TRUE)
# names(all_derep_reverse) <- all_sample.names
ecomol_dadaFs <- dada(ecomol_derep_forward, err=run3_errF, multithread=TRUE)
ecomol_dadaRs <- dada(ecomol_derep_reverse, err=run3_errR, multithread=TRUE)
all_dadaFs <- c(ecomol_dadaFs,LGC_2_dadaFs,LGC_1_dadaFs)
all_dadaRs <- c(ecomol_dadaRs,LGC_2_dadaRs,LGC_1_dadaRs)
names(all_dadaFs)Merge read pairs
On this step the forward an reverse reads are merged, by overlap, in order to reconstruct the insert full sequence. As we have samples from three runs, they are all worked independently.
# 15 - merge read pairs ----
#run1 ----
run1_mergers <- mergePairs(dadaF = LGC_1_dadaFs,
derepF = LGC_1_derep_forward,
dadaR = LGC_1_dadaRs,
derepR = LGC_1_derep_reverse,
minOverlap = 20,
maxMismatch = 0, # changed from 0 to 1 since a lot was being left out for single mismatch
returnRejects = TRUE,
verbose=TRUE)
#run2 ----
run2_mergers <- mergePairs(dadaF = LGC_2_dadaFs,
derepF = LGC_2_derep_forward,
dadaR = LGC_2_dadaRs,
derepR = LGC_2_derep_reverse,
minOverlap = 20,
maxMismatch = 0, # changed from 0 to 1 since a lot was being left out for single mismatch
returnRejects = TRUE,
verbose=TRUE)
#run1 ----
run3_mergers <- mergePairs(dadaF = ecomol_dadaFs,
derepF = ecomol_derep_forward,
dadaR = ecomol_dadaRs,
derepR = ecomol_derep_reverse,
minOverlap = 20,
maxMismatch = 0, # changed from 0 to 1 since a lot was being left out for single mismatch
returnRejects = TRUE,
verbose=TRUE)
all_mergers <- c(run3_mergers,run2_mergers,run1_mergers)
names(all_mergers)
length(all_dadaFs)
length(all_dadaRs)
head(all_mergers[[12]])
length(all_dadaFs)
names(all_mergers)
str(all_mergers)
class(all_mergers)
# all_seqtab <- makeSequenceTable(samples = c(run3_mergers,run2_mergers,run1_mergers)) #talvez essa função aceite varios mergers
all_seqtab <- makeSequenceTable(samples = all_mergers)
dim(all_seqtab)
View(all_seqtab)
str(all_seqtab)
# Inspect distribution of sequence lengths
table(nchar(getSequences(all_seqtab)))
table(nchar(getSequences(all_seqtab))) %>% plot()
names(all_dadaFs)
names(all_derep_forward)
names(all_dadaRs)
names(all_derep_reverse)Remove chimeras
Chimeras are artificial read pairs that might have been generated erroneously on sequencing. The DADA2 package estimates the probability of a sequence to be chimeric given the abundancy of its parental sequnces. After chimeric sequences removal, the remaining ASVs length distribution is assessed. On further steps it will be used to restrict analisys to ASVs compatible with each primer amplicons’ length interval, in order to keep of unexpected ASVs.
# 16 - remove chimeras ----
# any(colnames(C1conc_seqtab) %in% colnames(all_seqtab))
all_seqtab.nochim <- removeBimeraDenovo(all_seqtab, method="consensus", multithread=TRUE, verbose=TRUE)
dim(all_seqtab.nochim)
sum(all_seqtab.nochim)/sum(all_seqtab) # = 0.8404743 , perda de 16% na abundancia
#count proportion of ASVs of a given length
table(nchar(getSequences(all_seqtab.nochim)))
table(nchar(getSequences(all_seqtab.nochim))) %>% plot()
rownames(all_seqtab.nochim)
View(all_seqtab.nochim)
str(all_seqtab.nochim)Count reads and remaining ASVs
# 17 - count reads proportion throughout the pipeline ----
getN <- function(x) sum(getUniques(x))
#preparing subtables with named rows to combine latter
#raw files
names(primers_n_samples$`Read file`) <- primers_n_samples$Library
raw_reads <- primers_n_samples %>% filter(Stage %in% c("R1","R2"))
raw_reads_counts <- ShortRead::countFastq(dirPath = raw_reads$`Read file`) %>% as_tibble(rownames = "Read file")
raw_reads_counts <- left_join(x = raw_reads_counts, y = (raw_reads %>% mutate(`Read file` = basename(`Read file`))
),by = "Read file")
tbl_raw_FWD <- raw_reads_counts[raw_reads_counts$Stage %in% c("R1"),] %>% select(File_name, records) %>% `colnames<-`(c("File_name", "Raw FWD"))
tbl_raw_REV <- raw_reads_counts[raw_reads_counts$Stage %in% c("R2"),] %>% select(File_name, records) %>% `colnames<-`(c("File_name", "Raw REV"))
tbl_Denoised_FWD <- (sapply(all_dadaFs, getN) %>% as_tibble(rownames = "File_name")) %>% `colnames<-`(c("File_name", "Denoised FWD"))
tbl_Denoised_REV <- (sapply(all_dadaRs, getN) %>% as_tibble(rownames = "File_name")) %>% `colnames<-`(c("File_name", "Denoised REV"))
tbl_Merged <- (rowSums(all_seqtab) %>% as_tibble(rownames = "File_name")) %>% `colnames<-`(c("File_name", "Merged"))
tbl_Non_chimeric <- (rowSums(all_seqtab.nochim) %>% as_tibble(rownames = "File_name")) %>% `colnames<-`(c("File_name", "Non-chimeric"))
# combine all counts by sample to plot
all_track <- all_filtered_out %>% as_tibble(rownames = "File_name") %>%
mutate(`File_name` = str_remove(string = `File_name`, pattern = "_R1_cutadapt.fastq.gz")) %>%
left_join(tbl_raw_FWD,by = "File_name") %>%
left_join(tbl_raw_REV,by = "File_name") %>%
left_join(tbl_Denoised_FWD,by = "File_name") %>%
left_join(tbl_Denoised_REV,by = "File_name") %>%
left_join(tbl_Merged,by = "File_name") %>%
left_join(tbl_Non_chimeric,by = "File_name") %>%
left_join(primers_n_samples[primers_n_samples$Stage == "R1",],by = "File_name") %>%
select(!c("Stage", "Read file"))
colnames(all_track) <- c("File_name","N-cleaned", "Filtered","Raw FWD", "Raw REV", "Denoised FWD", "Denoised REV", "Merged", "Non-Chimeric", "Type", "Group", "Library", "Primer", "Run")
# Combine tables together (if there is more than one)
track_tbl <- bind_rows(all_track)
{
all_track$File_name[all_track$File_name == "Cassaum"] <- "Positive Control\n(P.glauca)"
all_track$File_name[all_track$File_name == "Da19"] <- "Da19"
all_track$File_name[all_track$File_name == "Da20"] <- "Da20"
all_track$File_name[all_track$File_name == "Da21"] <- "Da21"
all_track$File_name[all_track$File_name == "Da22"] <- "Da22"
all_track$File_name[all_track$File_name == "Da23-mif"] <- "Da23-mif"
all_track$File_name[all_track$File_name == "Da23-neo"] <- "Da23-neo"
all_track$File_name[all_track$File_name == "neg-PCR2"] <- "neg-PCR2"
all_track$File_name[all_track$File_name == "pJequei-N-norm-M"] <- "Non-normalized JQmc\nMiFish"
all_track$File_name[all_track$File_name == "pJequei-N-norm-N"] <- "Non-normalized JQmc\nNeoFish"
all_track$File_name[all_track$File_name == "pJequei-N-norm-T"] <- "Non-normalized JQmc\nTeleo"
all_track$File_name[all_track$File_name == "pJequei-norm-M"] <- "Normalized JQmc\nMiFish"
all_track$File_name[all_track$File_name == "pJequei-norm-N"] <- "Normalized JQmc\nNeoFish"
all_track$File_name[all_track$File_name == "pJequei-norm-T"] <- "Normalized JQmc\nTeleo"
all_track$File_name[all_track$File_name == "SFJQ-mif"] <- "Normalized SFJQmc\nMiFish"
all_track$File_name[all_track$File_name == "SFJQ-neo"] <- "Normalized SFJQmc\nNeoFish"
all_track$File_name[all_track$File_name == "SFnNorm-mi"] <- "Non-normalized SFmc\nMiFish"
all_track$File_name[all_track$File_name == "SFnNorm-neo"] <- "Non-normalized SFmc\nNeoFish"
all_track$File_name[all_track$File_name == "SFNorm-mi"] <- "Normalized SFmc\nMiFish"
all_track$File_name[all_track$File_name == "SFNorm-neo"] <- "Normalized SFmc\nNeoFish"
}
# save reads counts table
writexl::write_xlsx(x = all_track,
path = "~/prjcts/fish_eDNA/sfjq/results/sfjq_read_counts_along_quality_control.xlsx",
col_names = TRUE,format_headers = TRUE)
# plot reads proportion troughout the pipeline ----
track_tbl$Primer %>% unique()
track_tbl$File_name %>% unique()
#TODO
# https://bhaskarvk.github.io/colormap/
#https://www.thinkingondata.com/something-about-viridis-library/
#set colors here ss
#perda por filtrar N
all_track %>% mutate(perda = `N-cleaned`/`Raw FWD`)
#18 - set colors for downstream plots ----
# colors
scales::show_col(colors5)
colors5 <- c("#017504","#000791","#820000","#780058","#ff5500") #neo,mi,tel,all
colors_norm <- c("#017504","#4fc952",
"#000791","#3862eb",
"#820000","#bf4b4b")
scales::show_col(colors_norm)
scales::show_col(colors5)
#PLOT2 - sample track plot ----
# # track_tbl$File_name %>% paste0('"\n"',collapse = "") %>% cat()
# track_tbl$File_name %>% unique() %>% base::sort() %>% paste0(collapse = '\n') %>% cat()
# sample_levels
{
track_tbl$File_name[track_tbl$File_name == "Cassaum"] <- "Positive Control\n(P.glauca)"
track_tbl$File_name[track_tbl$File_name == "Da19"] <- "Da19"
track_tbl$File_name[track_tbl$File_name == "Da20"] <- "Da20"
track_tbl$File_name[track_tbl$File_name == "Da21"] <- "Da21"
track_tbl$File_name[track_tbl$File_name == "Da22"] <- "Da22"
track_tbl$File_name[track_tbl$File_name == "Da23-mif"] <- "Da23-mif"
track_tbl$File_name[track_tbl$File_name == "Da23-neo"] <- "Da23-neo"
#track_tbl$File_name[track_tbl$File_name == "neg-PCR2"] <-
track_tbl$File_name[track_tbl$File_name == "pJequei-N-norm-M"] <- "Non-normalized JQmc\nMiFish"
track_tbl$File_name[track_tbl$File_name == "pJequei-N-norm-N"] <- "Non-normalized JQmc\nNeoFish"
track_tbl$File_name[track_tbl$File_name == "pJequei-N-norm-T"] <- "Non-normalized JQmc\nTeleo"
track_tbl$File_name[track_tbl$File_name == "pJequei-norm-M"] <- "Normalized JQmc\nMiFish"
track_tbl$File_name[track_tbl$File_name == "pJequei-norm-N"] <- "Normalized JQmc\nNeoFish"
track_tbl$File_name[track_tbl$File_name == "pJequei-norm-T"] <- "Normalized JQmc\nTeleo"
track_tbl$File_name[track_tbl$File_name == "SFJQ-mif"] <- "Normalized SFJQmc\nMiFish"
track_tbl$File_name[track_tbl$File_name == "SFJQ-neo"] <- "Normalized SFJQmc\nNeoFish"
track_tbl$File_name[track_tbl$File_name == "SFnNorm-mi"] <- "Non-normalized SFmc\nMiFish"
track_tbl$File_name[track_tbl$File_name == "SFnNorm-neo"] <- "Non-normalized SFmc\nNeoFish"
track_tbl$File_name[track_tbl$File_name == "SFNorm-mi"] <- "Normalized SFmc\nMiFish"
track_tbl$File_name[track_tbl$File_name == "SFNorm-neo"] <- "Normalized SFmc\nNeoFish"
}
sample_levels <- c(
"Da23-mif", "Normalized SFJQmc\nMiFish",
"Da23-neo", "Normalized SFJQmc\nNeoFish",
"Da20","Non-normalized SFmc\nMiFish",
"Da19","Non-normalized SFmc\nNeoFish",
"Da22","Normalized SFmc\nMiFish",
"Da21","Normalized SFmc\nNeoFish",
"Non-normalized JQmc\nNeoFish","Non-normalized JQmc\nMiFish","Non-normalized JQmc\nTeleo",
"Normalized JQmc\nNeoFish","Normalized JQmc\nMiFish","Normalized JQmc\nTeleo",
"Positive Control\n(P.glauca)","neg-PCR2")
# Prepare counts for ploting ----
track_tbl <- track_tbl %>%
gather(key = "Stage",
value = "Read Number",
"Raw REV","Raw FWD",
"N-cleaned", "Filtered", "Denoised FWD",
"Denoised REV", "Merged", "Non-Chimeric") %>%
mutate(Stage = factor(Stage, levels = c("Non-Chimeric", "Merged", "Denoised REV", "Denoised FWD", "Filtered","N-cleaned", "Raw REV","Raw FWD"))) %>%
mutate(
Primer = factor(Primer, levels = c("NeoFish", "MiFish", "Teleo","NeoFish/MiFish", "NeoFish/MiFish/Teleo")),
File_name = factor(File_name,levels = sample_levels))
options(scipen = 22)
# track_tbl %>% base::sort(track_tbl$Sample)
# ploting ----
track_plot <- track_tbl %>%
# filter(Run %in% c("LGC_MiniSeq_1", "LGC_MiniSeq_2")) %>%
# filter(Group %in% c("DNA pool")) %>%
ggplot(aes(y = Stage,x = `Read Number`, fill = Primer, group = Stage)) +
geom_bar(stat="identity") +
geom_hline(yintercept = 300000, col = 1, linetype = 2) +
scale_fill_manual(labels = c("NeoFish", "MiFish", "Teleo", "NeoFish/MiFish","NeoFish/MiFish/Teleo"),
values = alpha(colour = colors5,
alpha = 0.75)) +
labs(title = "LGC eDNA 1st & 2nd runs",
subtitle = "Read counts per library and filtering step",
x = "Read counts",
y = "Data filtering step")+
facet_wrap(~File_name,ncol = 6) +
coord_fixed(ratio = 60000) +
theme_bw(base_size = 7) +
theme(legend.position = "bottom") +
theme(axis.title = ggtext::element_markdown())
track_plot
# save plot
ggsave(file = "~/prjcts/fish_eDNA/sfjq/results/figs/SFJQ_sample_track_plot.png",
plot = track_plot,
device = "png",
width = 12,
height = 10,
units = "cm",
dpi = 600)
# save plot
ggsave(file = "~/prjcts/fish_eDNA/sfjq/results/figs/SFJQ_sample_track_plot.svg",
plot = track_plot,
device = "svg",
width = 12,
height = 10,
units = "cm",
dpi = 600)
ggsave(file = "~/prjcts/fish_eDNA/sfjq/results/figs/SFJQ_sample_track_plot.pdf",
plot = track_plot,
device = "pdf",
width = 20,
height = 16,
units = "cm",
dpi = 600)Reads proportions are displayed below. The experimental design intended the same read yield for all libs, between 200K a 250K reads. The deviations of this reange are probably due to dosage/pipetting errors.
Classify taxonomy
On this step the ASVs identified by the DADA2 pipeline, jointly for all libraries of each primer, are associated (or not) to any of the sequences on the Reference 12S Sequences Database. DADA2 has two strategies to identify taxa. The first, assignSpecies, identify perfect matches of the ASVs in the Reference Database. The second, assignTaxonomy, use a RDP Naive Bayesian Classifier algorithm (Wang, 2007) with kmer size 8 and 100 bootstrap replicates to associate ASVs to the Reference Database Sequences. In the latter, the taxonomy ranks classification is proportional to the sequence similarity, although this relation is not yet clear to us.
#19 - classify taxonomy exactly ----
all_sps <- dada2::assignSpecies(seqs = all_seqtab.nochim,allowMultiple = 10,
refFasta = "~/prjcts/fish_eDNA/data/refs/db/LGC/jul21/dada_tax_fullDB_order_SPs_jul21.fasta",
tryRC=TRUE,
n = 20000,
verbose = TRUE)
#check how many ASVs were exactly identified as species
View(all_sps)
all_csv_sp <- all_sps %>% as_tibble() %>% mutate(ASV = rownames(all_sps))
colnames(all_csv_sp) <- c("exact Genus", "exact Species", "ASV")#20 - classify taxonomy ----
all_taxa <- dada2::assignTaxonomy(seqs = all_seqtab.nochim,
refFasta = "~/prjcts/fish_eDNA/data/refs/db/LGC/jul21/dada_tax_fullDB_order_jul21.fasta",
multithread=TRUE, tryRC=TRUE,taxLevels = c("Kingdom","Phylum","Class","Order","Family", "Genus", "Species","Specimen","Basin"),outputBootstraps = TRUE)
all_taxa$bootHere the DADA2 pipeline ends.
Phyloseq
On this step the ASVs associated to taxonomic ranks by DADA2 and their respective counts by library, are combined using the Phyloseq package.
Generate sample metadata table
Here the experiment metadata is associated to each sample.
# 22 - create sample table ----
#create a sample table for each primer
# primers_n_samples$File_name
all_samdf <- unique(primers_n_samples[1:6])
samdf<- all_samdf
#rownames must me assigned in order to the next step to work
samdf <- samdf %>% as.data.frame()
rownames(samdf) <- samdf$File_nameThis sample metadata table was created with the information available for the samples analyzed on this first run. This table must be customized for each experiment.
Phyloseq data interpretation
#23 - interpret dada on phyloseq ----
all_ps <- phyloseq(otu_table(all_seqtab.nochim, taxa_are_rows = FALSE),
sample_data(samdf),
tax_table(all_taxa$tax))
# tax_table(all_taxa))
rownames(all_seqtab.nochim)Merge and Flex Phyloseq results
Many different graphics can be generated, together or in isolation, for all primers/libraries and taxonomic ranks.
#24 - merge ps analisys ----
#melt phyloseq object into tbl
all_ps_tbl <- psmelt(all_ps) %>% as_tibble() %>% filter(Abundance >= 1)
colnames(all_ps_tbl)[colnames(all_ps_tbl) == "OTU"] <- "ASV"
unique(all_ps_tbl$ASV)
# unique(neo_ps_tbl$ASV)
# unique(mif_ps_tbl$ASV)
all_ps_tbl$Sample %>% unique()
all_ps_tbl$Primer %>% unique()
#concatenate exact species table
all_ps_tbl <- left_join(by = "ASV",x=all_ps_tbl,y= all_csv_sp)
# backup table
# all_ps_tbl_bckp <- all_ps_tbl
# all_ps_tbl <- all_ps_tbl_bckpmetaBLASTEr - Identify ASVs with inhouse BLASTn
This package is currently under development, but fully functional. You will need a working NCBI-BLAST+ installed and a BLAST formated reference DB on the same linux server your Rstudio-server is running (but we are improoving it to run on IOS).
# blastn ----
install.packages('BLASTr', repos = "https://heronoh.r-universe.dev")
# Annotate all ASVs by blastN
asvs_blast <- all_ps_tbl$ASV %>% unique() %>% as.character()
#Identify using metaBLASTr package ----
# paralela com 2 threads ----
tictoc::tic("Parallel - Furrr 2 threads")
blast_res <- BLASTr::parallel_blast(
db_path = "/data/databases/nt_jun2023/nt",
asvs = asvs_blast_all,
out_file = "~/prjcts/fish_eDNA/sfjq/results/blast/blast_out_res_1.csv",
out_RDS = "~/prjcts/fish_eDNA/sfjq/results/blast/blast_out_res_1.RDS",
total_cores = 80,
perc_id = 80,
num_threads = 2,
perc_qcov_hsp = 80,
num_alignments = 3,
blast_type = "blastn"
)
tictoc::toc()#
# #Save env
base::save.image("~/prjcts/fish_eDNA/sfjq//env-canastra_posBLAST-25jul23.RData")
colnames(blast_res)
# blast_res <- blast_res %>% rename("OTU" ="Sequence")
# blast_res <- blast_res %>% rename("Sequence" ="OTU")
blast_res_full <- bind_rows(blast_res) %>%
select(-c("OTU")) %>%
filter(!is.na(`1_subject header`))
nrow(blast_res)
dim(blast_res)
blast_res <- blast_res %>% filter(`1_res` == 1 ) #remover o que não deu nada
str(blast_res)Rename samples for plots
primers_n_samples
sample_levels
{
all_ps_tbl$File_name[all_ps_tbl$File_name == "Cassaum"] <- "Positive Control\n(P.glauca)"
all_ps_tbl$File_name[all_ps_tbl$File_name == "Da19"] <- "Non-normalized SFmc\nNeoFish B"
all_ps_tbl$File_name[all_ps_tbl$File_name == "Da20"] <- "Non-normalized SFmc\nMiFish B"
all_ps_tbl$File_name[all_ps_tbl$File_name == "Da21"] <- "Normalized SFmc\nNeoFish B"
all_ps_tbl$File_name[all_ps_tbl$File_name == "Da22"] <- "Normalized SFmc\nMiFish B"
all_ps_tbl$File_name[all_ps_tbl$File_name == "Da23-mif"] <- "SFJQ-mif B"
all_ps_tbl$File_name[all_ps_tbl$File_name == "Da23-neo"] <- "SFJQ-neo B"
all_ps_tbl$File_name[all_ps_tbl$File_name == "neg-PCR2"] <-"neg-PCR2"
all_ps_tbl$File_name[all_ps_tbl$File_name == "pJequei-N-norm-M"] <- "Non-normalized JQmc\nMiFish"
all_ps_tbl$File_name[all_ps_tbl$File_name == "pJequei-N-norm-N"] <- "Non-normalized JQmc\nNeoFish"
all_ps_tbl$File_name[all_ps_tbl$File_name == "pJequei-N-norm-T"] <- "Non-normalized JQmc\nTeleo"
all_ps_tbl$File_name[all_ps_tbl$File_name == "pJequei-norm-M"] <- "Normalized JQmc\nMiFish"
all_ps_tbl$File_name[all_ps_tbl$File_name == "pJequei-norm-N"] <- "Normalized JQmc\nNeoFish"
all_ps_tbl$File_name[all_ps_tbl$File_name == "pJequei-norm-T"] <- "Normalized JQmc\nTeleo"
all_ps_tbl$File_name[all_ps_tbl$File_name == "SFJQ-mif"] <- "Normalized SFJQmc\nMiFish"
all_ps_tbl$File_name[all_ps_tbl$File_name == "SFJQ-neo"] <- "Normalized SFJQmc\nNeoFish"
all_ps_tbl$File_name[all_ps_tbl$File_name == "SFnNorm-mi"] <- "Non-normalized SFmc\nMiFish"
all_ps_tbl$File_name[all_ps_tbl$File_name == "SFnNorm-neo"] <- "Non-normalized SFmc\nNeoFish"
all_ps_tbl$File_name[all_ps_tbl$File_name == "SFNorm-mi"] <- "Normalized SFmc\nMiFish"
all_ps_tbl$File_name[all_ps_tbl$File_name == "SFNorm-neo"] <- "Normalized SFmc\nNeoFish"
}
{
all_ps_tbl$Sample[all_ps_tbl$Sample == "Cassaum"] <- "Positive Control\n(P.glauca)"
all_ps_tbl$Sample[all_ps_tbl$Sample == "Da19"] <- "Non-normalized SFmc\nNeoFish B"
all_ps_tbl$Sample[all_ps_tbl$Sample == "Da20"] <- "Non-normalized SFmc\nMiFish B"
all_ps_tbl$Sample[all_ps_tbl$Sample == "Da21"] <- "Normalized SFmc\nNeoFish B"
all_ps_tbl$Sample[all_ps_tbl$Sample == "Da22"] <- "Normalized SFmc\nMiFish B"
all_ps_tbl$Sample[all_ps_tbl$Sample == "Da23-mif"] <- "Normalized SFJQmc\nMiFish B"
all_ps_tbl$Sample[all_ps_tbl$Sample == "Da23-neo"] <- "Normalized SFJQmc\nNeoFish B"
all_ps_tbl$Sample[all_ps_tbl$Sample == "neg-PCR2"] <- "neg-PCR2"
all_ps_tbl$Sample[all_ps_tbl$Sample == "pJequei-N-norm-M"] <- "Non-normalized JQmc\nMiFish"
all_ps_tbl$Sample[all_ps_tbl$Sample == "pJequei-N-norm-N"] <- "Non-normalized JQmc\nNeoFish"
all_ps_tbl$Sample[all_ps_tbl$Sample == "pJequei-N-norm-T"] <- "Non-normalized JQmc\nTeleo"
all_ps_tbl$Sample[all_ps_tbl$Sample == "pJequei-norm-M"] <- "Normalized JQmc\nMiFish"
all_ps_tbl$Sample[all_ps_tbl$Sample == "pJequei-norm-N"] <- "Normalized JQmc\nNeoFish"
all_ps_tbl$Sample[all_ps_tbl$Sample == "pJequei-norm-T"] <- "Normalized JQmc\nTeleo"
all_ps_tbl$Sample[all_ps_tbl$Sample == "SFJQ-mif"] <- "Normalized SFJQmc\nMiFish"
all_ps_tbl$Sample[all_ps_tbl$Sample == "SFJQ-neo"] <- "Normalized SFJQmc\nNeoFish"
all_ps_tbl$Sample[all_ps_tbl$Sample == "SFnNorm-mi"] <- "Non-normalized SFmc\nMiFish"
all_ps_tbl$Sample[all_ps_tbl$Sample == "SFnNorm-neo"] <- "Non-normalized SFmc\nNeoFish"
all_ps_tbl$Sample[all_ps_tbl$Sample == "SFNorm-mi"] <- "Normalized SFmc\nMiFish"
all_ps_tbl$Sample[all_ps_tbl$Sample == "SFNorm-neo"] <- "Normalized SFmc\nNeoFish"
}
all_ps_tbl$Group %>% unique() %>% base::sort()
# all_ps_tbl$Group <- all_ps_tbl$Group %>% unfactor()
{
all_ps_tbl$Group[all_ps_tbl$Group %in% c("JqNnorm")] <- "Non-normalized JQmc"
all_ps_tbl$Group[all_ps_tbl$Group %in% c("JqNorm")] <- "Normalized JQmc"
all_ps_tbl$Group[all_ps_tbl$Group %in% c("SFnNorm")] <- "Non-normalized SFmc"
all_ps_tbl$Group[all_ps_tbl$Group %in% c("SFNorm")] <- "Normalized SFmc"
all_ps_tbl$Group[all_ps_tbl$Group %in% c("SFJQ")] <- "Normalized SFJQmc"
all_ps_tbl$Group[all_ps_tbl$Group %in% c("Positive control")] <- "Positive control\n(P. glauca)"
}
all_ps_tbl$Group %>% unique()
all_ps_tbl$Group <- all_ps_tbl$Group %>% factor(levels = c("Non-normalized JQmc",
"Normalized JQmc",
"Non-normalized SFmc",
"Normalized SFmc",
"Normalized SFJQmc",
"Positive control\n(P. glauca)"))
sample_levels <- c(
"Normalized SFJQmc\nMiFish B", "Normalized SFJQmc\nMiFish",
"Normalized SFJQmc\nNeoFish B", "Normalized SFJQmc\nNeoFish",
"Normalized SFmc\nMiFish B","Normalized SFmc\nMiFish",
"Non-normalized SFmc\nMiFish B","Non-normalized SFmc\nMiFish",
"Normalized SFmc\nNeoFish B","Normalized SFmc\nNeoFish",
"Non-normalized SFmc\nNeoFish B","Non-normalized SFmc\nNeoFish",
"Non-normalized JQmc\nMiFish","Normalized JQmc\nMiFish",
"Non-normalized JQmc\nNeoFish","Normalized JQmc\nNeoFish",
"Non-normalized JQmc\nTeleo","Normalized JQmc\nTeleo",
"Positive Control\n(P.glauca)","neg-PCR2")
# all_ps_tbl_blast$Sample[all_ps_tbl_blast$Sample %in% c("pool não-normalizado\nMiFish")]
all_ps_tbl$Sample <- all_ps_tbl$Sample %>% factor(levels = sample_levels)
class(asvs_blast)
all_ps_tbl_blast <- left_join(x = all_ps_tbl,y = blast_res,by = "ASV")
colnames(all_ps_tbl_blast)
#all_ps_tbl_blast_bckp <- all_ps_tbl_blast
#all_ps_tbl_blast <- all_ps_tbl_blast_bckpASVs seqs
#25 - recover all ASVs sequences to prepare fasta ----
#all ----
# giving our seq headers more manageable names (ASV_1, ASV_2...)
# all_asv_seqs <- tibble("ASV" = colnames(seqtab.nochim))
all_asv_seqs <- tibble("ASV" = asvs_blast)
all_asv_seqs <- all_asv_seqs %>%
mutate("ASV length" = nchar(ASV),
"ASV header" = as.character(""))
all_asv_seqs <- all_asv_seqs[base::order(all_asv_seqs$`ASV length`),]
for (i in 1:nrow(all_asv_seqs)) {
all_asv_seqs$`ASV header`[i] <- paste0(">ASV_", i, "_", all_asv_seqs$`ASV length`[i], "bp")
}
#combine ASV headers and all_ps_tbl
all_ps_tbl_blast <- dplyr::left_join(x = all_ps_tbl_blast,
y = all_asv_seqs,
by = "ASV" )
# making and writing out a fasta of our final ASV seqs with tax
for (asv in 1:nrow(all_asv_seqs)) {
tax <- all_ps_tbl_blast %>%
filter(ASV == all_asv_seqs$ASV[asv]) %>%
select("Kingdom", "Phylum", "Class", "Order", "Family", "Genus", "Species", "Specimen") %>%
unique() %>%
paste0(collapse = "|")
all_asv_seqs$`ASV header`[asv] <- paste0(all_asv_seqs$`ASV header`[asv],"_",tax)
# if (condition) {
# fazer algum teste pra ver ser ta certo
# }
}
#write fasta file with ASVs and Taxonomy
all_asv_fasta <- c(rbind(all_asv_seqs$`ASV header`, all_asv_seqs$ASV))
write(all_asv_fasta, "~/prjcts/fish_eDNA/sfjq/results/sfjq_all_ASVs_all_primers.fasta")SWARM - ASVs to OTUs
# #swarm
asvs_abd <- all_ps_tbl_blast %>%
group_by(`ASV`,`ASV header`) %>%
mutate("ASV total abundance" = sum(Abundance)) %>%
select(c(`ASV`,`ASV header`,`ASV total abundance`)) %>%
unique() %>%
mutate(`ASV header` = paste0(`ASV header`,"_",`ASV total abundance`))
asvs_abd$ASV %>% unique()
asvs_abd$`ASV header` %>% unique()
#write fasta file with ASVs and abundance
# all_asv_fasta_abd <- c(rbind(asvs_abd$`ASV header primer`, asvs_abd$`ASV`))
all_asv_fasta_abd <- c(rbind(asvs_abd$`ASV header`, asvs_abd$`ASV`))
# write(all_asv_fasta_abd, "~/prjcts/fish_eDNA/sfjq/results/sfjq_ASVs_abd_primer.fasta")
write(all_asv_fasta_abd, paste0(results_path,"/sfjq_ASVs_abd.fasta"))
# ~/prjcts/fish_eDNA/sfjq/swarm$ swarm -t 50 ~/prjcts/fish_eDNA/sfjq/results/sfjq_ASVs_abd.fasta -s sfjq_swarm.stats -o sfjq_swarm.out -w sfjq_representative_OTUs.fasta -i sfjq_swarm.structure -f
swarm_clust <- readr::read_lines("~/prjcts/fish_eDNA/sfjq/swarm/sfjq_swarm.out")
asvs_abd <- asvs_abd %>% mutate("OTU"= 0)
for (asv in 1:nrow(asvs_abd)){
for (line in 1:length(swarm_clust)) {
if (str_detect(string = swarm_clust[line],
pattern = str_remove(asvs_abd$`ASV header`[asv],
pattern = ">"))) {
asvs_abd$OTU[asv] <- line
}
}
}
all_ps_tbl_blast <- left_join(x = all_ps_tbl_blast,y = asvs_abd[,c(1,3,4)],by="ASV" )
# all_ps_tbl_blast %>% select(`final ID`,OTU) %>% View()
# all_ps_tbl_blast %>% select(`final ID`,OTU) %>% select(OTU) %>% unique()
# all_ps_tbl_blast %>% select(ASV,`final ID`,OTU) %>% select(ASV) %>% unique()
all_ps_tbl_blast$OTU %>% unique()
all_ps_tbl_blast$Group %>% unique()Calculate sample abundances —-
#add ASV legth to table
# all_ps_tbl_blast_bckp2 <- all_ps_tbl_blast
# all_ps_tbl_blast <- all_ps_tbl_blast_bckp2
all_ps_tbl_blast <- all_ps_tbl_blast %>%
mutate("Relative abundance to all samples" = 0,
"Relative abundance on sample" = 0,
"Sample total abundance" = 0)
abd_total <- sum(all_ps_tbl_blast$Abundance)
all_ps_tbl_blast <- all_ps_tbl_blast %>%
group_by(Sample) %>%
mutate("Sample total abundance" = sum(Abundance),
"Relative abundance to all samples" = Abundance/abd_total,
"Relative abundance on sample" = Abundance/`Sample total abundance`) %>%
ungroup()Set final identification from all possibilities
all_ps_tbl_blast <- all_ps_tbl_blast %>%
mutate(`exact GenSp` = paste(`exact Genus`,`exact Species`,sep=" "))
all_ps_tbl_blast <- all_ps_tbl_blast %>%
mutate("final ID" = if_else((`exact Species` %in% c(NA,"NA", "NA NA")),
if_else((Species %in% c(NA,"NA")),
if_else(Genus %in% c(NA,"NA"),
substr(as.character(`1_subject header`),1,30),
Genus),
Species),
as.character(`exact GenSp`)))#Group/correct species for ploting
# all_ps_tbl_blast_bckp3 <- all_ps_tbl_blast
#Species detected
all_ps_tbl_blast$`final ID` %>% unique() %>% base::sort()
{
all_ps_tbl_blast$`final ID`[(all_ps_tbl_blast$`final ID` %in% c("Astyanax aff_fasciatus","Astyanax cf_fasciatus"))] <- "Astyanax fasciatus"
all_ps_tbl_blast$`final ID`[(all_ps_tbl_blast$`final ID` %in% c("Astyanax cf_lacustris"))] <- "Astyanax lacustris"
all_ps_tbl_blast$`final ID`[(all_ps_tbl_blast$`final ID` %in% c("Characidium sp"))] <- "Characidium"
all_ps_tbl_blast$`final ID`[(all_ps_tbl_blast$`final ID` %in% c("Hypostomus sp"))] <- "Hypostomus"
all_ps_tbl_blast$`final ID`[(all_ps_tbl_blast$`final ID` %in% c("Hoplias malabaricus/sp"))] <- "Hoplias malabaricus"
all_ps_tbl_blast$`final ID`[(all_ps_tbl_blast$`final ID` %in% c("Rhamdia aff_quelen"))] <- "Rhamdia quelen"
all_ps_tbl_blast$`final ID`[(all_ps_tbl_blast$`final ID` %in% c("Coptodon zillii KAUM:I:90126 m"))] <- "Coptodon zillii"
all_ps_tbl_blast$`final ID`[(all_ps_tbl_blast$`final ID` %in% c("Trachelyopterus cf_galeatus/galeatus"))] <- "Trachelyopterus galeatus"
}Identify primers expected ASV legth range
# create ranges column
all_ps_tbl_blast <- all_ps_tbl_blast %>%
mutate("Expected length" = "FALSE")
# fill ranges column with expected primer insert ranges
for (asv in 1:nrow(all_ps_tbl_blast)) {
if (all_ps_tbl_blast$Primer[asv] == "NeoFish") {
if (all_ps_tbl_blast$`ASV length`[asv] >= 185 && all_ps_tbl_blast$`ASV length`[asv] <= 200) {
all_ps_tbl_blast$`Expected length`[asv] <- "in range"
}else{
all_ps_tbl_blast$`Expected length`[asv] <- "out of range"
}
}
if (all_ps_tbl_blast$Primer[asv] == "MiFish") {
if (all_ps_tbl_blast$`ASV length`[asv] >= 165 && all_ps_tbl_blast$`ASV length`[asv] <= 180) {
all_ps_tbl_blast$`Expected length`[asv] <- "in range"
}else{
all_ps_tbl_blast$`Expected length`[asv] <- "out of range"
}
}
if (all_ps_tbl_blast$Primer[asv] == "Teleo") {
if (all_ps_tbl_blast$`ASV length`[asv] >= 60 && all_ps_tbl_blast$`ASV length`[asv] <= 75) {
all_ps_tbl_blast$`Expected length`[asv] <- "in range"
}else{
all_ps_tbl_blast$`Expected length`[asv] <- "out of range"
}
}
if (all_ps_tbl_blast$Primer[asv] == "NeoFish/MiFish") {
if (all_ps_tbl_blast$`ASV length`[asv] >= 165 && all_ps_tbl_blast$`ASV length`[asv] <= 200) {
all_ps_tbl_blast$`Expected length`[asv] <- "in range"
}else{
all_ps_tbl_blast$`Expected length`[asv] <- "out of range"
}
}
if (all_ps_tbl_blast$Primer[asv] == "NeoFish/MiFish/Teleo") {
if (all_ps_tbl_blast$`ASV length`[asv] %in% c(60:75,165:180,185:200)) {
all_ps_tbl_blast$`Expected length`[asv] <- "in range"
}else{
all_ps_tbl_blast$`Expected length`[asv] <- "out of range"
}
}
}
#factorize comlumn
all_ps_tbl_blast$`Expected length` <- as.factor(all_ps_tbl_blast$`Expected length`)#Reorder table
paste0(colnames(all_ps_tbl_blast),"\n") %>% cat()
# all_ps_tbl_blast_bckp4 <- all_ps_tbl_blast
# all_ps_tbl_blast <- all_ps_tbl_blast_bckp4
all_ps_tbl_blast <-
all_ps_tbl_blast %>%
select(c("Sample","Group","Type","Primer","File_name","Library","Run",
"final ID",
"Abundance",
"Relative abundance to all samples",
"Relative abundance on sample",
"Sample total abundance",
"Kingdom","Phylum","Class","Order","Family",
"Genus","Species","Specimen","Basin",
"exact Genus","exact Species",
"exact GenSp",
"1_subject header","1_subject",
"1_indentity","1_length",
# "1_mismatches","1_gaps",
# "1_query start","1_query end","1_subject start",
# "1_subject end","1_e-value","1_bitscore",
"2_subject header","2_subject",
"2_indentity","2_length",
# "2_mismatches","2_gaps",
# "2_query start","2_query end","2_subject start",
# "2_subject end","2_e-value","2_bitscore",
"3_subject header","3_subject",
"3_indentity","3_length",
# "3_mismatches","3_gaps",
# "3_query start","3_query end","3_subject start",
# "3_subject end","3_e-value","3_bitscore",
"ASV","ASV length","ASV header","Expected length","OTU"
))
# paste0(colnames(all_ps_tbl_blast),"\n") %>% cat()
names(all_ps_tbl_blast)[which(names(all_ps_tbl_blast)=="ASV")] <- "ASV (Sequence)"
names(all_ps_tbl_blast)[which(names(all_ps_tbl_blast)== "ASV length")] <- "ASV size (pb)"###save complete table
#order by abundance
smp_abd_ID <- all_ps_tbl_blast[rev(base::order(all_ps_tbl_blast$Abundance)),] %>%
filter(`Abundance` > 0)
dim(smp_abd_ID)
writexl::write_xlsx(x = smp_abd_ID,
path = "~/prjcts/fish_eDNA/sfjq/results/sfjq_all_analysis_info_06-03-22.xlsx",
col_names = TRUE,format_headers = TRUE)
ASVs_per_sample <- all_ps_tbl_blast %>%
# filter(Run %in% c("LGC_MiniSeq_1", "LGC_MiniSeq_2")) %>%
filter(!`final ID` %in% c(NA,"NA")) %>%
mutate("Sample" = factor(Sample,levels = sample_levels)) %>%
group_by(Sample) %>%
summarize("Library" = unique(`Library`),
"Group" = unique(Group),
"Primer" = unique(Primer),
"Total ASV" = length(unique(`ASV (Sequence)`[Abundance != 0])),
"ASVs out of range" = length(unique(`ASV (Sequence)`[Abundance != 0 & `Expected length` == "out of range"])),
"ASVs in range" = length(unique(`ASV (Sequence)`[Abundance != 0 & `Expected length` == "in range"]))
,
"Identified Species" = length(unique(`final ID`[Abundance != 0 & `Expected length` == "in range"]))
)
writexl::write_xlsx(x = ASVs_per_sample,
path = "~/prjcts/fish_eDNA/sfjq/results/sfjq_ASVs_per_sample_06-07-21.xlsx",
col_names = TRUE,format_headers = TRUE)export list of ASVs and identifications
smp_abd_ID %>%
dplyr::select(c(Primer,`ASV (Sequence)`,`ASV header`,`ASV size (pb)`,
`Kingdom`, `Phylum`, `Class`, `Order`,
`Family`, `Genus`, `Species`, `Specimen`,OTU)) %>%
unique() %>%
View()
#all ----
all_asv_seqs_ID <- smp_abd_ID %>%
dplyr::select(c(Primer,`ASV (Sequence)`,`ASV header`,`ASV size (pb)`,
`Kingdom`, `Phylum`, `Class`, `Order`,
`Family`, `Genus`, `Species`, `Specimen`,OTU)) %>%
unique()
# making and writing out a fasta of our final ASV seqs with tax
all_asv_seqs_ID <- all_asv_seqs_ID %>%
rowwise() %>%
mutate("Tax_header" = paste0(`ASV header`,"-",
"OTU_",OTU,"-",
Primer,"-ID:",
`Kingdom`, "|",
`Phylum`, "|",
`Class`, "|",
`Order`, "|",
`Family`, "|",
`Genus`, "|",
`Species`, "|",
`Specimen`))
#write fasta file with ASVs and Taxonomy
all_asv_fasta_ID <- c(rbind(all_asv_seqs_ID$Tax_header, all_asv_seqs_ID$`ASV (Sequence)`))
write(all_asv_fasta_ID, "~/prjcts/fish_eDNA/mock_communities/results/Hilario_et_al_2023-SFJQ-all_IDed_ASVs_by_primer.fasta")curing: manual checking of the species assignment
all_ps_tbl_bl_cur <- smp_abd_ID
all_ps_tbl_bl_cur <- all_ps_tbl_bl_cur %>%
mutate("revised final ID" = `final ID`)
all_ps_tbl_bl_cur$`revised final ID` %>% unique() %>% sort()
#correct misidentifications one by one
{
all_ps_tbl_bl_cur$`revised final ID`[all_ps_tbl_bl_cur$`revised final ID` %in% c("Prochilodus")] <- "Prochilodus argenteus/hartii"
all_ps_tbl_bl_cur$`revised final ID`[all_ps_tbl_bl_cur$`revised final ID` %in% c("Prochilodus argenteus")] <- "Prochilodus argenteus/hartii"
all_ps_tbl_bl_cur$`revised final ID`[all_ps_tbl_bl_cur$`revised final ID` %in% c("Pimelodus")] <- "Pimelodus pohli"
all_ps_tbl_bl_cur$`revised final ID`[all_ps_tbl_bl_cur$`revised final ID` %in% c("Astyanax")] <- "Astyanax lacustris"
all_ps_tbl_bl_cur$`revised final ID`[all_ps_tbl_bl_cur$`revised final ID` %in% c("Hypostomus")] <- "Hypostomus alatus"
all_ps_tbl_bl_cur$`revised final ID`[all_ps_tbl_bl_cur$`revised final ID` %in% c("NA elegans/gilbert")] <- "Cyphocharax gilbert"
all_ps_tbl_bl_cur$`revised final ID`[all_ps_tbl_bl_cur$`revised final ID` %in% c("NA lepidura/xenodon")] <- "Curimatella lepidura"
all_ps_tbl_bl_cur$`revised final ID`[all_ps_tbl_bl_cur$`revised final ID` %in% c("Roeboides xenodon")] <- "Curimatella lepidura"
all_ps_tbl_bl_cur$`revised final ID`[all_ps_tbl_bl_cur$`revised final ID` %in% c("Curimatella lepidura")] <- "Roeboides xenodon"
all_ps_tbl_bl_cur$`revised final ID`[(all_ps_tbl_bl_cur$`revised final ID` %in% c("Hoplias brasiliensis/intermedius")) &
all_ps_tbl_bl_cur$Group %in% c("Non-normalized SFmc","Normalized SFmc")] <- "Hoplias intermedius"
all_ps_tbl_bl_cur$`revised final ID`[(all_ps_tbl_bl_cur$`revised final ID` %in% c("Hoplias brasiliensis/intermedius")) &
all_ps_tbl_bl_cur$Group %in% c("Non-normalized JQmc","Normalized JQmc")] <- "Hoplias brasiliensis"
all_ps_tbl_bl_cur$`revised final ID`[(all_ps_tbl_bl_cur$`revised final ID` %in% c("Hoplias intermedius")) &
all_ps_tbl_bl_cur$Group %in% c("Normalized SFJQmc")] <- "Hoplias brasiliensis/intermedius"
all_ps_tbl_bl_cur$`revised final ID`[(all_ps_tbl_bl_cur$`revised final ID` %in% c("Hoplias intermedius")) &
all_ps_tbl_bl_cur$Group %in% c("Non-normalized JQmc","Normalized JQmc")] <- "Hoplias brasiliensis"
}Identify expected species
As this was a controlled experiment, we must identify the species that were expected and those who were not.
#duplicate final ID so we can identify partially identified species
# all_ps_tbl_blast_bckp5 <- all_ps_tbl_blast
# all_ps_tbl_blast <- all_ps_tbl_blast_bckp5
#
# all_ps_tbl_blast <- all_ps_tbl_bl_cur %>%
# mutate(`revised final ID` = `final ID`)
# expctd_sps_tbl <- read.csv(file = "~/prjcts/fish_eDNA/sfjq/data/sfjq_species.csv",
# expctd_sps_tbl <- read.csv(file = "~/prjcts/fish_eDNA/sfjq/data/sfjq_species_06mar22.csv",
# expctd_sps_tbl <- read.csv(file = "~/prjcts/fish_eDNA/sfjq/data/sfjq_species_10mar22.csv",
expctd_sps_tbl <- read.csv(file = "~/prjcts/fish_eDNA/sfjq/data/sfjq_species_02jun22.csv",
header = TRUE, check.names = FALSE) %>% as_tibble()
#mudei o T. chalceus de 0.0073 para 0.0299 no pool SF
colnames(expctd_sps_tbl)[colnames(expctd_sps_tbl) == "Species"] <- "revised final ID"Proportions table
As this was a controlled experiment, we must identify the species that were expected and those who were not.
# tabelas de proporções ----
# JQmc ----
# criando a tabela de proporções do JQ
# if used left_join, p hartii wont show up
all_ps_tbl_jq <- full_join(
all_ps_tbl_bl_cur[all_ps_tbl_bl_cur$Sample %in% c(
"Normalized JQmc\nNeoFish", "Non-normalized JQmc\nNeoFish",
"Normalized JQmc\nMiFish", "Non-normalized JQmc\nMiFish",
"Normalized JQmc\nTeleo", "Non-normalized JQmc\nTeleo"),],
expctd_sps_tbl[expctd_sps_tbl$Pool=="JQ",c(2:9)],
by = "revised final ID")
# all_ps_tbl_jq %>% select(`revised final ID`,Abundance,`Relative abundance on sample`, 64:73) %>% View()
all_ps_tbl_jq$`Expected Species` <- "not expected"
all_ps_tbl_jq$`revised final ID` %>% unique()
all_ps_tbl_jq <- all_ps_tbl_jq %>% mutate(
# `Expected Species`=if_else((!is.na(`Full name`) & (.$`revised final ID` %in% expected_sps)),"expected","not expected")
`Expected Species`=if_else((!is.na(`Full name`)),"expected","not expected")
)
colnames(all_ps_tbl_jq)
jq_proportions <- all_ps_tbl_jq %>%
select(c(1:24,37:50)) %>%
pivot_longer(cols = c("Percentage on respective Norm pool", "Percentage on respective Non-norm pool" ),
names_to = "Pool",values_to = "Proportion") %>%
# mutate(Proportion = Proportion*100) %>%
mutate(Sample = factor(Sample,levels = c(
"Normalized JQmc\nNeoFish", "Non-normalized JQmc\nNeoFish",
"Normalized JQmc\nMiFish", "Non-normalized JQmc\nMiFish",
"Normalized JQmc\nTeleo", "Non-normalized JQmc\nTeleo"
# ,
# "Non-normalized SFmc\nMiFish","Non-normalized SFmc\nNeoFish",
# "Normalized SFmc\nMiFish","Normalized SFmc\nNeoFish",
# "Normalized SFJQmc\nMiFish", "Normalized SFJQmc\nNeoFish"
))) %>%
filter((Sample %in% c("Non-normalized JQmc\nNeoFish", "Non-normalized JQmc\nMiFish", "Non-normalized JQmc\nTeleo"
# , "Non-normalized SFmc\nMiFish","Non-normalized SFmc\nNeoFish"
) & Pool %in% c("Percentage on respective Non-norm pool"
) )|(Sample %in% c("Normalized JQmc\nNeoFish", "Normalized JQmc\nMiFish", "Normalized JQmc\nTeleo"
# , "Normalized SFmc\nMiFish", "Normalized SFmc\nNeoFish", "Normalized SFJQmc\nMiFish", "Normalized SFJQmc\nNeoFish"
) & Pool %in% c("Percentage on respective Norm pool") )) %>%
group_by(Sample,`revised final ID`) %>%
summarize(Proportion = unique(Proportion),
`Relative abundance on sample` = sum(`Relative abundance on sample`),
Sample = unique(Sample),
# `revised final ID` = unique(`revised final ID`),
`revised final ID` = unique(`revised final ID`),
Primer = unique(Primer),
`Expected Species` = unique(`Expected Species`),
Pool = unique(Pool),
`Num ASVs` = length(`ASV (Sequence)`),
`Num OTUs` = length(unique(OTU))) %>%
ungroup()
#SFmc ----
# criando a tabela de proporções do
all_ps_tbl_sf <- full_join(
all_ps_tbl_bl_cur[all_ps_tbl_bl_cur$Sample %in% c(
"Normalized SFmc\nNeoFish", "Non-normalized SFmc\nNeoFish",
"Normalized SFmc\nMiFish", "Non-normalized SFmc\nMiFish"),],
expctd_sps_tbl[expctd_sps_tbl$Pool=="SF",c(2:9)],
by = "revised final ID")
# all_ps_tbl_jq %>% select(`revised final ID`,Abundance,`Relative abundance on sample`, 64:73) %>% View()
all_ps_tbl_sf$`Expected Species` <- "not expected"
all_ps_tbl_sf$`revised final ID` %>% unique()
all_ps_tbl_sf <- all_ps_tbl_sf %>% mutate(
# `Expected Species`=if_else((!is.na(`Full name`) & (.$`revised final ID` %in% expected_sps)),"expected","not expected")
`Expected Species`=if_else((!is.na(`Full name`)),"expected","not expected")
)
colnames(all_ps_tbl_sf)
sf_proportions <- all_ps_tbl_sf %>%
# select(c(1:15,63:68,73:74)) %>%
select(c(1:24,37:50)) %>%
pivot_longer(cols = c("Percentage on respective Norm pool", "Percentage on respective Non-norm pool" ),
names_to = "Pool",values_to = "Proportion") %>%
# mutate(Proportion = Proportion*100) %>%
mutate(Sample = factor(Sample,levels = c(
"Normalized SFmc\nNeoFish", "Non-normalized SFmc\nNeoFish",
"Normalized SFmc\nMiFish", "Non-normalized SFmc\nMiFish"
# ,
# "Non-normalized SFmc\nMiFish","Non-normalized SFmc\nNeoFish",
# "Normalized SFmc\nMiFish","Normalized SFmc\nNeoFish",
# "Normalized SFJQmc\nMiFish", "Normalized SFJQmc\nNeoFish"
))) %>%
filter((Sample %in% c("Non-normalized SFmc\nNeoFish", "Non-normalized SFmc\nMiFish"
# , "Non-normalized SFmc\nMiFish","Non-normalized SFmc\nNeoFish"
) & Pool %in% c("Percentage on respective Non-norm pool"
) )|(Sample %in% c("Normalized SFmc\nNeoFish", "Normalized SFmc\nMiFish"
# , "Normalized SFmc\nMiFish", "Normalized SFmc\nNeoFish", "Normalized SFJQmc\nMiFish", "Normalized SFJQmc\nNeoFish"
) & Pool %in% c("Percentage on respective Norm pool") )) %>%
group_by(Sample,`revised final ID`) %>%
summarize(Proportion = unique(Proportion),
`Relative abundance on sample` = sum(`Relative abundance on sample`),
Sample = unique(Sample),
# `revised final ID` = unique(`revised final ID`),
`revised final ID` = unique(`revised final ID`),
Primer = unique(Primer),
`Expected Species` = unique(`Expected Species`),
Pool = unique(Pool),
`Num ASVs` = length(`ASV (Sequence)`),
`Num OTUs` = length(unique(OTU))) %>%
ungroup()
#SFJQmc ----
# View(expctd_sps_tbl[expctd_sps_tbl$Pool=="SFJQ",c(2:9)])
# criando a tabela de proporções do SFJQ
all_ps_tbl_sfjq <- full_join(
all_ps_tbl_bl_cur[all_ps_tbl_bl_cur$Sample %in% c(
"Normalized SFJQmc\nNeoFish", "Normalized SFJQmc\nMiFish"),],
expctd_sps_tbl[expctd_sps_tbl$Pool=="SFJQ",c(2:9)],
by = "revised final ID")
# all_ps_tbl_jq %>% select(`revised final ID`,Abundance,`Relative abundance on sample`, 64:73) %>% View()
all_ps_tbl_sfjq$`Expected Species` <- "not expected"
all_ps_tbl_sfjq$`revised final ID` %>% unique()
all_ps_tbl_sfjq <- all_ps_tbl_sfjq %>% mutate(
# `Expected Species`=if_else((!is.na(`Full name`) & (.$`revised final ID` %in% expected_sps)),"expected","not expected")
`Expected Species`=if_else((!is.na(`Full name`)),"expected","not expected")
)
colnames(all_ps_tbl_sfjq)
sfjq_proportions <- all_ps_tbl_sfjq %>%
select(c(1:24,37:50)) %>%
# select(c(1:15,63:68,73:74)) %>%
pivot_longer(cols = c("Percentage on respective Norm pool", "Percentage on respective Non-norm pool" ),
names_to = "Pool",values_to = "Proportion") %>%
# mutate(Proportion = Proportion*100) %>%
mutate(Sample = factor(Sample,levels = c(
"Normalized SFJQmc\nNeoFish", "Normalized SFJQmc\nMiFish"
))) %>%
filter((Sample %in% c("Normalized SFJQmc\nNeoFish", "Normalized SFJQmc\nMiFish"
) & Pool %in% c("Percentage on respective Norm pool"
) )) %>%
group_by(Sample,`revised final ID`) %>%
summarize(Proportion = unique(Proportion),
`Relative abundance on sample` = sum(`Relative abundance on sample`),
Sample = unique(Sample),
# `revised final ID` = unique(`revised final ID`),
`revised final ID` = unique(`revised final ID`),
Primer = unique(Primer),
`Expected Species` = unique(`Expected Species`),
Pool = unique(Pool),
`Num ASVs` = length(`ASV (Sequence)`),
`Num OTUs` = length(unique(OTU))) %>%
ungroup()
#this table will be used
all_ps_tbl_sfjq_full <- dplyr::bind_rows(all_ps_tbl_sfjq,all_ps_tbl_sf,all_ps_tbl_jq)
all_ps_tbl_sfjq_full %>% colnames() %>% unique() %>% paste0(collapse = '",\n"') %>% cat()Pearson correlations between DNA input and sequence yield
#correlação entre o DNA input e reads ABD -----
# JQmc
{
jq_df_neo_norm <- jq_proportions %>%
ungroup() %>%
filter(Sample %in% c("Normalized JQmc\nNeoFish")) %>%
select(c(2,3,4)) %>% as.data.frame() %>% na.exclude()
jq_df_mif_norm <- jq_proportions %>%
ungroup() %>%
filter(Sample %in% c("Normalized JQmc\nMiFish")) %>%
select(c(2,3,4)) %>% as.data.frame() %>% na.exclude()
jq_df_tel_norm <- jq_proportions %>%
ungroup() %>%
filter(Sample %in% c("Normalized JQmc\nTeleo")) %>%
select(c(2,3,4)) %>% as.data.frame() %>% na.exclude()
jq_df_neo_skew <- jq_proportions %>%
ungroup() %>%
filter(Sample %in% c("Non-normalized JQmc\nNeoFish")) %>%
select(c(2,3,4)) %>% as.data.frame() %>% na.exclude()
jq_df_mif_skew <- jq_proportions %>%
ungroup() %>%
filter(Sample %in% c("Non-normalized JQmc\nMiFish")) %>%
select(c(2,3,4)) %>% as.data.frame() %>% na.exclude()
jq_df_tel_skew <- jq_proportions %>%
ungroup() %>%
filter(Sample %in% c("Non-normalized JQmc\nTeleo")) %>%
select(c(2,3,4)) %>% as.data.frame() %>% na.exclude()
#SF
sf_df_neo_norm <- sf_proportions %>%
ungroup() %>%
filter(Sample %in% c("Normalized SFmc\nNeoFish")) %>%
select(c(2,3,4)) %>% as.data.frame() %>% na.exclude()
sf_df_mif_norm <- sf_proportions %>%
ungroup() %>%
filter(Sample %in% c("Normalized SFmc\nMiFish")) %>%
select(c(2,3,4)) %>% as.data.frame() %>% na.exclude()
sf_df_neo_skew <- sf_proportions %>%
ungroup() %>%
filter(Sample %in% c("Non-normalized SFmc\nNeoFish")) %>%
select(c(2,3,4)) %>% as.data.frame() %>% na.exclude()
sf_df_mif_skew <- sf_proportions %>%
ungroup() %>%
filter(Sample %in% c("Non-normalized SFmc\nMiFish")) %>%
select(c(2,3,4)) %>% as.data.frame() %>% na.exclude()
# SFJQ
sfjq_df_neo_norm <- sfjq_proportions %>%
ungroup() %>%
filter(Sample %in% c("Normalized SFJQmc\nNeoFish")) %>%
select(c(2,3,4)) %>% as.data.frame() %>% na.exclude()
sfjq_df_mif_norm <- sfjq_proportions %>%
ungroup() %>%
filter(Sample %in% c("Normalized SFJQmc\nMiFish")) %>%
select(c(2,3,4)) %>% as.data.frame() %>% na.exclude()
}
#correlações
#JQmc
cor.test(x = jq_df_neo_norm$Proportion ,
y = jq_df_neo_norm$`Relative abundance on sample` ,
method = "pearson")
cor.test(x = jq_df_neo_skew$Proportion ,
y = jq_df_neo_skew$`Relative abundance on sample` ,
method = "pearson")
cor.test(x = jq_df_mif_norm$Proportion ,
y = jq_df_mif_norm$`Relative abundance on sample` ,
method = "pearson")
cor.test(x = jq_df_mif_skew$Proportion ,
y = jq_df_mif_skew$`Relative abundance on sample` ,
method = "pearson")
cor.test(x = jq_df_tel_norm$Proportion ,
y = jq_df_tel_norm$`Relative abundance on sample` ,
method = "pearson")
cor.test(x = jq_df_tel_skew$Proportion ,
y = jq_df_tel_skew$`Relative abundance on sample` ,
method = "pearson")
#SF
cor.test(x = sf_df_neo_norm$Proportion ,
y = sf_df_neo_norm$`Relative abundance on sample` ,
method = "pearson",)
cor.test(x = sf_df_neo_skew$Proportion ,
y = sf_df_neo_skew$`Relative abundance on sample` ,
method = "pearson")
cor.test(x = sf_df_mif_norm$Proportion ,
y = sf_df_mif_norm$`Relative abundance on sample` ,
method = "pearson")
cor.test(x = sf_df_mif_skew$Proportion ,
y = sf_df_mif_skew$`Relative abundance on sample` ,
method = "pearson")Richness analysis on Vegan
library(vegan)
# data(dune)
# decorana(dune)
# class(dune)
#1- prepare data for entry in vegan ----
all_ps_blst_vegan <- all_ps_tbl_bl_cur %>%
filter(`Expected length` %in% c("in range")) %>%
mutate("Normalization" = str_split(.$Group,pattern = " ",2,simplify = TRUE)[,1],
"Mock Community" = str_split(.$Group,pattern = " ",2,simplify = TRUE)[,2]) %>%
filter(!(Sample %in% c("Positive Control\n(P.glauca)","neg-PCR2"))) %>% #remove control samples
select(c(Sample,Group,Normalization,`Mock Community`,Type,Primer,File_name,Library,Run,`final ID`,`Relative abundance on sample`)) %>%
group_by(Sample,`final ID`,Group,Type,Primer,File_name,Library,Run,Normalization,`Mock Community`) %>%
summarise(`Relative abundance on sample` = sum(`Relative abundance on sample`)) %>%
pivot_wider(c(Sample,Group,Type,Primer,File_name,Library,Run,Normalization,`Mock Community`),names_from = `final ID` ,values_from = `Relative abundance on sample`) %>%
mutate_if(is.numeric, ~replace(., is.na(.), 0)) %>%
# mutate(Library = unfactor(Library)) %>%
mutate("Sample number" = 0) %>%
ungroup() %>%
select(`Sample number`, 1:(ncol(.)-1)) %>%
mutate(Normalization = factor(Normalization))
#2- associate sample numbers to sample names ----
for (sample in 1:nrow(all_ps_blst_vegan)) {
all_ps_blst_vegan$`Sample number`[sample] <- sample
}
#tirando as amostras da ecomol pra facilitar
all_ps_blst_vegan <- all_ps_blst_vegan[all_ps_blst_vegan$Run %in% c("LGC_MiniSeq_1", "LGC_MiniSeq_2"),]
colnames(all_ps_blst_vegan)
hist(colSums(all_ps_blst_vegan[,-c(1:10)]))
hist(rowSums(all_ps_blst_vegan[,-c(1:10)]))
all_ps_blst_vegan[,-c(1:10)]
all_ps_blst_vegan %>% select(Sample, `Sample number`)
# all_ps_blst_vegan %>% select(`Sample number`, 1:(ncol(.)-1))
#3- create data.frame of species counts: rownames are Sample numbers ----
all_ps_blst_vegan_df <- all_ps_blst_vegan %>%
# filter(Run %in% c("LGC_MiniSeq_1", "LGC_MiniSeq_2")) %>%
select(-c("Sample", "Group", "Type", "Primer", "File_name", "Library", "Run","Normalization","Mock Community")) %>%
select(base::sort(colnames(.))) %>%
as.data.frame()
#4- name rows as Sample numbers and remove column ----
row.names(all_ps_blst_vegan_df) <- all_ps_blst_vegan_df$`Sample number`
all_ps_blst_vegan_df <- all_ps_blst_vegan_df %>%
select(-c(`Sample number`))
library(vegan)
#5-
all_ps_ord <- decorana(veg = all_ps_blst_vegan_df)
all_ps_ord %>% summary()
all_ps_ord %>% str()
all_ps_ord$cproj
plot(all_ps_ord)
plot(all_ps_ord,type = "p")
plot(all_ps_ord,type = "c")
points(all_ps_ord, display = "sites", cex = 0.8, pch=21, col="red", bg="yellow")
text(all_ps_ord, display = "sites", cex=0.7, col="blue")
text(all_ps_ord, display = "spec", cex=0.7, col="blue")
#6- NMDS analisys ----
# library(vegan)
# data(varespec)
#6a- Calculate distances ----
all_ps_vg_dist <- vegdist(all_ps_blst_vegan_df, method="bray")
vegan::scores(all_ps_vg_dist)
# all_ps_vg_dist_metaMDS <- metaMDS(comm = all_ps_vg_dist, autotransform = FALSE)
# actually autotransform = FALSE doesn't seem to change the results
# plot(all_ps_vg_dist_metaMDS)
# all_ps_vg_dist_metaMDS_2 <- metaMDS(comm = all_ps_vg_dist, distance = "bray", k =2)
# plot(all_ps_vg_dist_metaMDS_2)
#selecionar apenas espécies esperadas?
all_ps_blst_vegan_df %>% ncol()
all_ps_blst_vegan_df <- all_ps_blst_vegan_df[,(colnames(all_ps_blst_vegan_df) %in% expected_sps)]
all_ps_blst_vegan_df %>% ncol()
all_ps_vg_dist <- vegdist(all_ps_blst_vegan_df, method="bray")
all_ps_ord <- decorana(veg = all_ps_blst_vegan_df)
all_ps_ord %>% summary()
all_ps_ord %>% str()
all_ps_ord$cproj
all_ps_ord
plot(all_ps_ord)
plot(all_ps_ord,type = "p")
plot(all_ps_ord,type = "c")
vegan::scores(all_ps_vg_dist)
# all_ps_blst_vegan_df[,(colnames(all_ps_blst_vegan_df) %in% expected_sps)] %>% colnames()
# all_ps_blst_vegan_df%>% colnames()
all_ps_vegan_ord_meta <- metaMDS(veg = all_ps_blst_vegan_df, comm = all_ps_vg_dist)
# actually autotransform = FALSE doesn't seem to change the results
plot(all_ps_vegan_ord_meta, type = "t")
all_ps_vegan_ord_meta %>% str()
all_ps_vegan_ord_meta$stress
#6b- extract NMDS scores from results
all_vegan_meta <- (vegan::scores(all_ps_vegan_ord_meta) %>% tidyr::as_tibble(rownames = "Sample number")) %>% mutate(`Sample number` = as.numeric(`Sample number`))
# all_vegan_meta <- as.data.frame(vegan::scores(all_ps_vegan_ord_meta))
#Using the scores function from vegan to extract the site scores and convert to a data.frame
# all_vegan_meta$`Sample number` <- rownames(all_vegan_meta) %>% as.numeric()
# all_vegan_meta %>% left_join()# create a column of site names, from the rownames of data.scores
# all_vegan_meta <- all_vegan_meta %>% as_tibble() # create a column of site names, from the rownames of data.scores
#7- bring NMDS scores to complete table
all_vegan_meta_tbl <- left_join(x = unique(all_ps_blst_vegan[,c(1:10)]),y = all_vegan_meta, by = "Sample number") %>%
mutate(Primer=factor(Primer,levels = c("NeoFish", "MiFish", "Teleo")),
`Mock Community`=factor(`Mock Community`))
library(factoextra)
library(ggforce)
nmds_PLOT <- all_vegan_meta_tbl %>%
# filter(Run %in% c("LGC_MiniSeq_1", "LGC_MiniSeq_2")) %>%
ggplot(aes(x = NMDS1,y = NMDS2, col = Primer,shape = Normalization,label = Sample,Group = `Mock Community`))+
# stat_ellipse()+
geom_point(size = 11)+
theme_light(base_size = 18) +
theme(legend.position="bottom") +
coord_fixed(ratio = 1) +
# ggrepel::geom_label_repel(label.size = 0.8,size = 3,min.segment.length = 2) +
# ggrepel::geom_text_repel(col="black",size = 3,min.segment.length = 2) +
# scale_shape_manual() %>%
scale_color_manual(
# labels = c("NeoFish", "MiFish", "Teleo", "NeoFish/MiFish", "NeoFish/MiFish/Teleo"),
labels = c("NeoFish", "MiFish", "Teleo"),
values = alpha(colour = colors_norm[c(1,3,5)] ))+
annotate(geom = "text",
x=c(0.275),y=c(-0.275),label=paste0("Stress: ",round(all_ps_vegan_ord_meta$stress,digits = 4)),size=5) +
# ADD ggforce's ellipses
ggforce::geom_mark_ellipse(inherit.aes = FALSE,
aes(x = NMDS1,y = NMDS2,
group=`Mock Community`,
label=`Mock Community`),
n = 100,
expand = 0.03,
label.fontsize = 20,con.cap = 0.1)
# facet_wrap(~`Mock Community`,ncol = 2)
#
nmds_PLOT
#
# ggsave(file = "~/prjcts/fish_eDNA/sfjq/results/figs/SFJQ_NMDS.pdf",
ggsave(file = "~/outros/sfjq_temp/SFJQ_NMDS.pdf",
plot = nmds_PLOT,
device = "pdf",
width = 40,
height =25,
units = "cm",
dpi = 300)
ggsave(file = "~/prjcts/fish_eDNA/sfjq/results/figs/SFJQ_NMDS.png",
plot = nmds_PLOT,
device = "png",
width = 31,
height =20,
units = "cm",
dpi = 300)
# anosim----
################################# anosin function###############################
anosin_auto<- function(tbl,cols_out, Coluna){
df <- tbl[,c(1,(1+cols_out):ncol(tbl))] %>%
as.data.frame() %>%
`rownames<-`(.$`Sample number`) %>%
select(-c("Sample number"))
ano <- anosim(df, grouping = tbl[[Coluna]],
permutations = 9999, distance = "bray", strata = NULL)
return(ano)
}
################################################################################
#Primers ----
#Todas MC juntas
all_ps_blst_vegan %>%
# filter(`Mock Community` %in% c("SFmc")) %>%
anosin_auto(cols_out = 10,Coluna = "Primer")
#Apenas JQ
all_ps_blst_vegan %>%
filter(`Mock Community` %in% c("JQmc")) %>%
anosin_auto(cols_out = 10,Coluna = "Primer")
#Apenas SF
all_ps_blst_vegan %>%
filter(`Mock Community` %in% c("SFmc")) %>%
anosin_auto(cols_out = 10,Coluna = "Primer")
#Apenas SFJQ
all_ps_blst_vegan %>%
filter(`Mock Community` %in% c("SFJQmc")) %>%
anosin_auto(cols_out = 10,Coluna = "Primer")
#Normalization ----
#Todas MC juntas
all_ps_blst_vegan %>%
anosin_auto(cols_out = 10,Coluna = "Normalization")
#Apenas JQ
all_ps_blst_vegan %>%
filter(`Mock Community` %in% c("JQmc")) %>%
anosin_auto(cols_out = 10,Coluna = "Normalization")
#Apenas SF
all_ps_blst_vegan %>%
filter(`Mock Community` %in% c("SFmc")) %>%
anosin_auto(cols_out = 10,Coluna = "Normalization")
#Apenas SFJQ
all_ps_blst_vegan %>%
filter(`Mock Community` %in% c("SFJQmc")) %>%
anosin_auto(cols_out = 10,Coluna = "Normalization")
all_vegan_meta_tbl %>%
filter(Run %in% c("LGC_MiniSeq_1","LGC_MiniSeq_2")) %>%
select(Sample,`Sample number`,Primer)Ploting ASVs
# all_ps_tbl_blast_bckp6 <- all_ps_tbl_blast
all_ps_tbl_blast <- all_ps_tbl_bl_cur
#28- ASVs plots by sample and species ----
options(set.seed(seed = 13))
#28a- ASV size distribution - alphabetical----
all_ps_tbl_blast$Run %>% unique()
ASV_size_by_Sample <- all_ps_tbl_blast %>%
filter(!Sample %in% c("Positive Control\n(P.glauca)")) %>%
filter(!Run %in% c("ecomol_iSeq")) %>%
mutate(Sample = factor(Sample,levels = sample_levels)) %>%
mutate(Primer = factor(Primer,levels = c("NeoFish", "MiFish",
"Teleo", "NeoFish/MiFish/Teleo"))) %>%
ggplot(aes(y=Sample,
x=`ASV size (pb)`,
colour = Primer,
size=`Relative abundance on sample`,
shape=`Expected length`
)) +
geom_jitter(height = 0.2,
width = 0) +
ggplot2::scale_colour_manual(
values = ggplot2::alpha(colour = colors5[1:4] ,alpha = 0.3)) +
coord_fixed(ratio = 8) +
scale_x_continuous(breaks = c(20,60,80,100,120,140,160,180,200,220,240,260,280,300,320,340),expand = c(0.02,0.02)) +
xlab("ASV length (bp)") +
ylab("Sample") +
ggtitle(label = "SFJQ mock communities ",
subtitle = "All ASVs found in samples, by length and abundance") +
theme_bw(base_size = 15) +
theme(legend.position = "right")
ASV_size_by_Sample
ggsave(file = "~/prjcts/fish_eDNA/sfjq/results/figs/3-ASV_size_by_sample.png",
plot = ASV_size_by_Sample,
device = "png",
width = 18,
height = 10,
dpi = 600)
ggsave(file = "~/prjcts/fish_eDNA/sfjq/results/figs/3-ASV_size_by_sample.svg",
plot = ASV_size_by_Sample,
device = "svg",
width = 18,
height = 10,
dpi = 600)
ggsave(file = "~/prjcts/fish_eDNA/sfjq/results/figs/3-ASV_size_by_sample.pdf",
plot = ASV_size_by_Sample,
device = "pdf",
width = 18,
height = 10,
dpi = 600)
dev.off()
##################### paper ################################# ----
#29 - ASVS - sample X species (12S) - distribution: blast----
all_ps_tbl_blast$Group %>%unique()
#Jq & SF DNA pools - ASVs size and species by sample----
all_ps_tbl_blast$Sample %>% unfactor() %>% unique() %>% base::sort()
all_ps_tbl_blast$`revised final ID` %>% unique() %>% base::sort() %>% paste0(collapse = '", \n"') %>% cat()
all_ps_tbl_blast$`final ID` %>% unique() %>% base::sort() %>% paste0(collapse = '", \n"') %>% cat()
pool_labels <- c(
"Normalized JQmc" = "Jequitinhonha\nNormalized DNA pool",
"Non-normalized JQmc" = "Jequitinhonha\nNon-Normalized DNA pool",
"Normalized SFJQmc" = "São Francisco & Jequitinhonha\nNormalized DNA pool",
"Non-normalized SFmc" = "São Francisco\nNon-Normalized DNA pool",
"Normalized SFmc" = "São Francisco\nNormalized DNA pool"
)
pools_levels <- c(
"Normalized JQmc",
"Non-normalized JQmc",
"Normalized SFJQmc",
"Normalized SFmc",
"Non-normalized SFmc"
)
#final ID levels
{
finalID_levels<- c(
#jq
"Astyanax lacustris",
"Australoheros sp",
"Delturus brevis",
"Eugerres brasilianus",
"Hypomasticus steindachneri",
"Hypostomus nigrolineatus",
"Megaleporinus elongatus",
"Megaleporinus garmani",
"Moenkhausia costae",
"Rhamdia quelen",
"Steindachneridion amblyurum",
"Wertheimeria maculata",
#ambos
"Gymnotus carapo",
"Hoplias",
"Hoplias brasiliensis",
"Hoplias intermedius",
"Hoplias malabaricus",
"Prochilodus",
"Prochilodus argenteus",
"Prochilodus costatus",
"Steindachnerina elegans",
"Trachelyopterus galeatus",
#sf
"Astyanax fasciatus",
"Brycon orthotaenia",
"Characidium lagosantense",
"Crenicichla lepidota",
# "Curimatella lepidura", esse é na vdd roeboides
"Roeboides xenodon",
"Eigenmannia virescens",
"Franciscodoras marmoratus",
"Hypostomus alatus",
"Imparfinis minutus",
"Leporinus reinhardti",
"Microglanis leptostriatus",
"Moenkhausia sanctaefilomenae",
"Myleus micans",
"Pamphorichthys hollandi",
"Phalloceros uai",
"Pimelodus maculatus",
"Pimelodus pohli",
"Pseudoplatystoma corruscans",
"Pterygoplichthys etentaculatus",
"Serrasalmus brandtii",
"Tetragonopterus chalceus",
#partial
"Astyanax",
"Hoplias brasiliensis/intermedius",
"Hypostomus",
"Pimelodus",
"Prochilodus argenteus/hartii",
#trash
"NA elegans/gilbert",
"NA lepidura/xenodon",
"Acestrorhynchus lacustris",
"Coptodon zillii",
"Cyphocharax gilbert",
"Geophagus brasiliensis",
"Planaltina myersi",
"Poecilia reticulata mitochondr"
)
}
finalID_levels[finalID_levels %>% duplicated()]
# final ID levels 2
{
finalID_levels <- c(
"Acestrorhynchus lacustris",
"Acinocheirodon melanogramma",
"Astyanax fasciatus",
"Astyanax lacustris",
"Australoheros sp",
"Bos taurus",
"Brycon orthotaenia",
"Characidium lagosantense",
"Coptodon zillii",
"Crenicichla lepidota",
# "Curimatella lepidura", agora é roeboides
"Roeboides xenodon",
"Cyphocharax gilbert",
"Delturus brevis",
"Eigenmannia virescens",
"Eugerres brasilianus",
"Franciscodoras marmoratus",
"Geophagus brasiliensis",
"Gymnotus carapo",
"Hoplias brasiliensis",
"Hoplias intermedius",
"Hoplias malabaricus",
"Hypomasticus steindachneri",
"Hypostomus alatus",
"Hypostomus nigrolineatus",
"Imparfinis minutus",
"Leporinus reinhardti",
"Megaleporinus elongatus",
"Megaleporinus garmani",
"Microglanis leptostriatus",
"Moenkhausia costae",
"Moenkhausia sanctaefilomenae",
"Myleus micans",
"Pamphorichthys hollandi",
"Phalloceros uai",
"Pimelodus maculatus",
"Pimelodus pohli",
"Planaltina myersi",
"Prionace glauca",
"Prochilodus argenteus",
"Prochilodus costatus",
"Prochilodus hartii",
"Pseudoplatystoma corruscans",
"Pterygoplichthys etentaculatus",
"Rhamdia quelen",
"Roeboides xenodon",
"Serrasalmus brandtii",
"Steindachneridion amblyurum",
"Tetragonopterus chalceus",
"Trachelyopterus galeatus",
"Wertheimeria maculata",
#partial
"Astyanax",
"Hoplias brasiliensis/intermedius",
"Hypostomus",
"Pimelodus",
"Prochilodus",
"Prochilodus argenteus/hartii")
}
sps_remove <- c(
NA,"NA",
"Acestrorhynchus lacustris",
"Acinocheirodon melanogramma",
"Bos taurus",
"Coptodon zillii",
"Curimatella lepidura",
"Eugerres brasilianus",
"Geophagus brasiliensis",
"Leporinus reinhardti",
"Moenkhausia costae",
"Planaltina myersi",
"Prionace glauca",
"Pseudoplatystoma corruscans"
)Images arcticle
Fold-change bar plots
##Ven diagram
##Upset plot
DNA/RRA correlation plots
colnames(all_ps_tbl_sfjq_full_uniq)
all_ps_tbl_sfjq_full_uniq$Group
all_ps_tbl_sfjq_full_uniq$MC
all_ps_tbl_sfjq_full_uniq$Normalization
######função pra plotar lm
# lm_eqn <- function(df){
# m <- lm(y ~ x, df);
# eq <- substitute(italic(y) == a + b %.% italic(x)*","~~italic(r)^2~"="~r2,
# list(a = format(unname(coef(m)[1]), digits = 2),
# b = format(unname(coef(m)[2]), digits = 2),
# r2 = format(summary(m)$r.squared, digits = 3)))
# as.character(as.expression(eq));
# }
#inclinação das retas ----
#LM
models_corr <- all_ps_tbl_sfjq_full_uniq %>%
filter(Normalization %in% c("Non-normalized")) %>%
# filter(Primer %in% c("NeoFish")) %>%
group_by(Primer,MC) %>%
select(c("Percentage on respective Non-norm pool", "Relative abundance on sample")) %>%
do(model = lm(formula = `Percentage on respective Non-norm pool` ~ `Relative abundance on sample`, data = .))
# lm(formula = `Percentage on respective Non-norm pool` ~ `Relative abundance on sample`)
# aov(formula = `Percentage on respective Non-norm pool` ~ `Relative abundance on sample`)
models_corr$model
models_corr$Primer
models_corr$MC
models_corr$model[[1]] %>% broom::glance(model) #NeoFish JQmc
models_corr$model[[2]] %>% broom::glance(model) #NeoFish SFmc
models_corr$model[[3]] %>% broom::glance(model) #MiFish JQmc
models_corr$model[[4]] %>% broom::glance(model) #MiFish SFmc
models_corr$model[[5]] %>% broom::glance(model) #Teleo JQmc
#AOV
models_corr <- all_ps_tbl_sfjq_full_uniq %>%
filter(Normalization %in% c("Non-normalized")) %>%
# filter(Primer %in% c("NeoFish")) %>%
group_by(Primer) %>%
select(c("Percentage on respective Non-norm pool", "Relative abundance on sample")) %>%
do(model = aov(formula = `Percentage on respective Non-norm pool` ~ `Relative abundance on sample`, data = .))
# lm(formula = `Percentage on respective Non-norm pool` ~ `Relative abundance on sample`)
# aov(formula = `Percentage on respective Non-norm pool` ~ `Relative abundance on sample`)
models_corr$model
models_corr$Primer
models_corr$model[[1]] %>% broom::tidy()
models_corr$model[[2]] %>% broom::tidy()
models_corr$model[[3]] %>% broom::tidy()
#JQmc ----
# jq_coef <- lm(`Percentage on respective Non-norm pool` ~ `Relative abundance on sample`,
# (all_ps_tbl_sfjq_full_uniq %>%
# filter(MC %in% c("JQmc")) %>%
# filter(Normalization %in% c("Non-normalized"))))
############################ tentando com a tib com norm e n norm na mesma coluna
tab_curated_SFJQ_all_pools %>% colnames()
sfjq_sp_corr <-
tab_curated_SFJQ_all_pools %>%
ggplot(aes(x=`input DNA (%)`,
y=`RRA (%)`,
col=Primer,
shape=Pool))+
geom_point() +
# geom_smooth(method=lm) +
# coord_fixed()+
scale_colour_manual(values = alpha(colour = colors_norm[c(1,3,5)] ,alpha = 0.8)) +
# scale_shape_manual(drop=TRUE) +
xlab("Input DNA (%)") +
ylab("Relative Read Abundance (%)") +
ggtitle("SFmc & JQmc: Correlation between\nInput DNA and RRA") +
scale_x_sqrt(breaks=c(0,0.0001,0.001,0.01,0.025,0.05,0.1,0.2,0.3,0.4,0.6,0.8,1)*100) +
scale_y_sqrt(breaks=c(0,0.0001,0.001,0.01,0.025,0.05,0.1,0.2,0.3,0.4,0.6,0.8,1)*100) +
coord_fixed(ratio = 1)+
geom_smooth(method=lm) +
theme_bw(base_size = 10) +
# facet_wrap(MC~Primer,ncol = 3)
facet_wrap(Primer~Group,ncol = 5)
# +
# scale_x_log10() +
# scale_y_log10()
# minor_breaks = mb
# minor_breaks = mb
ggsave(file = "~/prjcts/fish_eDNA/sfjq/results/figs/SFJQ_RRA_DNA_bySp2.png", plot = sfjq_sp_corr, device = "png", width = 30, height = 15, units = "cm", dpi = 600)
###########################
sfjq_sp_corr <- all_ps_tbl_sfjq_full_uniq %>%
# filter(MC %in% c("JQmc")) %>%
filter(Normalization %in% c("Non-normalized")) %>%
# mutate(`Percentage on respective Non-norm pool`= if_else(`Percentage on respective Non-norm pool` %in% c(NA,"NA"),0,`Percentage on respective Non-norm pool`)) %>%
# mutate(`Relative abundance on sample`= if_else(`Relative abundance on sample` %in% c(NA,"NA"),0,`Relative abundance on sample`)) %>% View()
ggplot(aes(x=`Percentage on respective Non-norm pool`*100,
y=`Relative abundance on sample`*100,
col=Primer,
shape=MC
))+
geom_point() +
# geom_smooth(method=lm) +
# coord_fixed()+
scale_colour_manual(values = alpha(colour = colors_norm[c(1,3,5)] ,alpha = 0.8)) +
# scale_shape_manual(drop=TRUE) +
xlab("Input DNA (%)") +
ylab("Relative Read Abundance (%)") +
ggtitle("SFmc & JQmc: Correlation between\nInput DNA and RRA") +
scale_x_sqrt(breaks=c(0,0.0001,0.001,0.01,0.025,0.05,0.1,0.2,0.3,0.4,0.6,0.8,1)*100) +
scale_y_sqrt(breaks=c(0,0.0001,0.001,0.01,0.025,0.05,0.1,0.2,0.3,0.4,0.6,0.8,1)*100) +
coord_fixed(ratio = 1)+
geom_smooth(method=lm) +
theme_bw(base_size = 10) +
# facet_wrap(MC~Primer,ncol = 3)
facet_wrap(Primer~Normalization,ncol = 3)
# +
# scale_x_log10() +
# scale_y_log10()
# minor_breaks = mb
# minor_breaks = mb
ggsave(file = "~/prjcts/fish_eDNA/sfjq/results/figs/SFJQ_RRA_DNA_bySp.png", plot = sfjq_sp_corr, device = "png", width = 30, height = 15, units = "cm", dpi = 600)
#SFmc ----
library("plotly")
sf_sp_corr <- all_ps_tbl_sfjq_full_uniq %>%
filter(MC %in% c("SFmc")) %>%
filter(Normalization %in% c("Non-normalized")) %>%
# mutate(`Percentage on respective Non-norm pool`= if_else(`Percentage on respective Non-norm pool` %in% c(NA,"NA"),0,`Percentage on respective Non-norm pool`)) %>%
# mutate(`Relative abundance on sample`= if_else(`Relative abundance on sample` %in% c(NA,"NA"),0,`Relative abundance on sample`)) %>% View()
ggplot(aes(x=`Percentage on respective Non-norm pool`*100,
y=`Relative abundance on sample`*100,
col=Primer,
shape=MC))+
geom_point() +
# geom_smooth(method=lm) +
# coord_fixed()+
scale_colour_manual(values = alpha(colour = colors_norm[c(1,3,5)] ,alpha = 0.8)) +
xlab("input DNA (%)") +
ylab("Relative Read Abundance (%)") +
ggtitle("SFmc: Correlation between\nInput DNA and RRA") +
scale_x_sqrt(breaks=c(0,0.0001,0.001,0.01,0.025,0.05,0.1,0.2,0.3,0.4,0.6,0.8,1)*100) +
scale_y_sqrt(breaks=c(0,0.0001,0.001,0.01,0.025,0.05,0.1,0.2,0.3,0.4,0.6,0.8,1)*100) +
coord_fixed(ratio = 1)+
geom_smooth(method=lm) +
theme_bw(base_size = 10) +
facet_wrap(~Primer,ncol = 3)
ggplotly(sf_sp_corr)
ggsave(file = "~/prjcts/fish_eDNA/sfjq/results/figs/SF_RRA_DNA_bySp.png", plot = sf_sp_corr, device = "png", width = 20, height = 15, units = "cm", dpi = 600)Aditional Graphics
# set colors ----
colors6 <- c("#19821c","#8dbc8f", #neo norm & non norm
"#171d9a","#8d90c7", #mif norm & non norm
"#8c1717","#c18d8d" #tel norm & non norm
)
scales::show_col(colors6)
# carregando tabela
# https://docs.google.com/spreadsheets/d/1sTsOaI999E9Py_f4ll5j838r7CVc991a8mPmd8LvykU/edit#gid=0
tab_curated_SFJQ_all_pools <- read.csv("~/prjcts/fish_eDNA/sfjq/data/SFJQ_all_pools-tabelas_curadas_para_o_R-SFJQmc-copy.csv",check.names = F) %>%
as_tibble()
tab_curated_SFJQ_all_pools <- tab_curated_SFJQ_all_pools %>%
filter(`input DNA (%)` != 0 & `RRA (%)` !=0) %>%
group_by(Pool,Normalization,Primer,Species) %>%
summarize(Pool = unique(Pool),
Normalization = unique(Normalization),
Status = unique(Status),
Species = unique(Species),
Primer = unique(Primer),
`Num ASVs` = `Num ASVs`,
`Num OTUs` = `Num OTUs`,
`input DNA (%)` = `input DNA (%)`,
`RRA (%)` = `RRA (%)`
# `Expected species` = length(unique(`revised final ID`[`Expected Species` %in% c("expected")])),
# `Expected species list` = list(unique(base::sort(`revised final ID`[`Expected Species` %in% c("expected")]))),
# `revised final ID`= unique(`revised final ID`),
# `RRA (%)` = sum(`Relative abundance on sample`),
# `Percentage on respective Norm pool` = unique(`Percentage on respective Norm pool`),
# `Percentage on respective Non-norm pool` = unique(`Percentage on respective Non-norm pool`),
# `Relative abundance on sample` = unique(`Relative abundance on sample`)
) %>%
ungroup() %>%
# mutate(`revised final ID`=factor(`revised final ID`
# # , levels = rev(finalID_levels)
# )) %>%
mutate(Primer = factor(Primer, levels = c("NeoFish", "MiFish", "Teleo", "NeoFish/MiFish","NeoFish/MiFish/Teleo"))) %>%
mutate(`Fold change (RRA/DNA input)` = gtools::foldchange(denom = `input DNA (%)`,num = `RRA (%)`)) %>%
unique()
# mutate(Group = factor(Group,levels = c("Normalized SFJQmc", "Non-normalized JQmc", "Normalized JQmc", "Non-normalized SFmc", "Normalized SFmc" ))) %>%
# mutate(MC = str_remove(Group,"Normalized |Non-normalized ")) %>%
# mutate(Normalization = str_remove(Group," SFmc| JQmc| SFJQmc"))
tab_curated_SFJQ_all_pools$`Fold change (RRA/DNA input)` %>% sort() %>% duplicated()
tab_curated_SFJQ_all_pools[c(which(tab_curated_SFJQ_all_pools$`Fold change (RRA/DNA input)` %>% as.character() %>% duplicated()),
which(tab_curated_SFJQ_all_pools$`Fold change (RRA/DNA input)` %>% as.character() %>% duplicated())-1),] %>% View()
# SFJQmc ----
## build tree ----
### read 12S db seqs for the species present in pools
SFJQ_Sps_seqs <- Biostrings::readDNAStringSet(filepath = "~/prjcts/fish_eDNA/sfjq/data/trees/SFJQmc-38_SPs_fused-unique.fas") %>%
# SFJQ_Sps_seqs <- Biostrings::readDNAStringSet(filepath = "~/outros/sfjq_temp/trees/SFJQmc-38_SPs_fused-unique.fas") %>%
DECIPHER::RemoveGaps()
### align seqs
SFJQ_Sps_algn <- DECIPHER::AlignSeqs(myXStringSet = SFJQ_Sps_seqs,
refinements = 100,
iterations = 100,
verbose = TRUE)
### generate distance matrix
SFJQ_Sps_dist <- DECIPHER::DistanceMatrix(myXStringSet = SFJQ_Sps_algn,
includeTerminalGaps = FALSE,
correction = "Jukes-Cantor",
processors = 20,
verbose = TRUE)
### generate dendrogram/tree from alignment and distance matrix
SFJQmc_tree <- ape::nj(SFJQ_Sps_dist)
# tree <- phangorn::NJ(SFJQ_Sps_dist)
class(SFJQmc_tree)
### save tree as newick
ape::write.tree(phy = SFJQmc_tree,file = "~/prjcts/fish_eDNA/sfjq/data/trees/SFJQmc-38_SPs_fused-unique_APEtree.nwk")
# ape::write.tree(phy = SFJQmc_tree,file = "~/outros/sfjq_temp/trees/SFJQmc-38_SPs_fused-unique_APEtree.nwk")
### read tree from file (or stay with the same object)
# SFJQmc_tree <- read.tree("~/outros/sfjq_temp/trees/SFJQmc-38_SPs_fused-unique_APEtree.nwk")
SFJQmc_tree <- read.tree("~/prjcts/fish_eDNA/sfjq/data/trees/SFJQmc-38_SPs_fused-unique_APEtree.nwk")
## species metadata ----
### read table with pools species, input DNA and RRA
# tab_curated_SFJQ_all_pools <- read.csv("~/outros/sfjq_temp/SFJQ_all_pools-tabelas_curadas_para_o_R-SFJQmc.csv",check.names = F)
# tab_curated_SFJQ_all_pools <- read.csv("~/prjcts/fish_eDNA/sfjq/data/SFJQ_all_pools-tabelas_curadas_para_o_R-SFJQmc.csv",check.names = F) %>%
# as_tibble()
#
# tab_curated_SFJQ_all_pools
tab_curated_SFJQ_all_pools %>% colnames()
tab_curated_SFJQ_all_pools %>% unique()
all_ps_tbl_sfjq_full_uniq %>% colnames()
# tab_curated_SFJQ_all_pools <- all_ps_tbl_sfjq_full_uniq
#converting the corrected table to the format required for next steps
tab_curated_SFJQ_all_pools <-
all_ps_tbl_sfjq_full_uniq %>%
pivot_longer(c("Percentage on respective Norm pool", "Percentage on respective Non-norm pool"),
names_to = "DNA Originary Pool", values_to = "input DNA (%)") %>%
pivot_longer(c("Recovered proportion norm", "Recovered proportion non norm"),
names_to = "Fold Change Originary Pool", values_to = "Fold Change") %>%
select(-c(
# "DNA Originary Pool", "RRA Originary Pool",
# "Sample,"
# "Group",
"Run"
)) %>%
# colnames()
# View()
rename(
Species = `revised final ID`,
`Num OTUs` = `OTUs`,
`Num ASVs` = `ASVs`,
`Num IDs` = `IDs`,
# `RRA (%)` = `Relative abundance on sample`,
# `Expected species`,
# `Expected species list`,
# `Fold Change` = `Ratio`,
`Pool` = `MC`) %>%
filter((`DNA Originary Pool` %in% c("Percentage on respective Norm pool") & `Normalization` %in% c("Normalized")) |
(`DNA Originary Pool` %in% c("Percentage on respective Non-norm pool") & `Normalization` %in% c("Non-normalized")) ) %>%
filter((`Fold Change Originary Pool` %in% c("Recovered proportion norm") & `Normalization` %in% c("Normalized")) |
(`Fold Change Originary Pool` %in% c("Recovered proportion non norm") & `Normalization` %in% c("Non-normalized")) ) %>%
select(-c("DNA Originary Pool", "Fold Change Originary Pool")) %>%
mutate(Status = if_else(`Expected species` == 0, "Contamination","Expected")) %>%
mutate(`RRA (%)` = `RRA (%)` * 100,
`input DNA (%)` = `input DNA (%)` * 100) %>% unite(Normalization, Primer, col = "Primer_norm",remove = F,sep = " ") %>%
mutate(Primer_norm = factor(Primer_norm, levels = c("Normalized NeoFish","Normalized MiFish","Normalized Teleo","Non-normalized NeoFish","Non-normalized MiFish","Non-normalized Teleo"))) %>% View()
# all_ps_tbl_sfjq_full_uniq %>% colnames()
# tab_curated_SFJQ_all_pools[sort(c(which(tab_curated_SFJQ_all_pools$`Fold Change` %>% as.character() %>% duplicated()),which(tab_curated_SFJQ_all_pools$`Fold Change`%>% as.character() %>% duplicated())-1)),] %>% View()
# tab_curated_SFJQ_all_pools[tab_curated_SFJQ_all_pools$`Fold Change` %>% duplicated(),] %>% View()
### tidy table
tab_curated_SFJQ <- tab_curated_SFJQ_all_pools %>%
as_tibble() %>%
filter(Status == "Expected") %>%
filter(Pool == "SFJQmc") %>%
# filter(MC == "SFJQmc") %>%
# filter(Pool == "SFJQmc") %>%
mutate(Primer = factor(Primer, levels = c("NeoFish","MiFish","Teleo")),
Species = factor(Species),
# `revised final ID` = factor(`revised final ID`),
Normalization = factor(Normalization),
Pool = factor(Pool),
Status = factor(Status),
# `RRA (%)` = as.numeric(`Relative abundance on sample`)*100,
`RRA (%)` = as.numeric(`RRA (%)`),
`input DNA (%)` = as.numeric(`input DNA (%)`))
## correct tips labels ----
### check tip names in tree
SFJQmc_tree$tip.label
### rename tree tips to mach table
SFJQmc_tree$tip.label
tab_curated_SFJQ$Species %>% unique() %>% sort()
{
SFJQmc_tree$tip.label[SFJQmc_tree$tip.label == "SF_1339_Prochilodus_costatus_JQ_2860"] <- "Prochilodus costatus"
SFJQmc_tree$tip.label[SFJQmc_tree$tip.label == "JQ_5612_Prochilodus_argenteus_hartii"] <- "Prochilodus argenteus/hartii"
SFJQmc_tree$tip.label[SFJQmc_tree$tip.label == "JQ_6586_Steindachnerina_elegans-Cyphocharax_gilbert"] <- "Cyphocharax gilbert"
SFJQmc_tree$tip.label[SFJQmc_tree$tip.label == "SF_1230_Serrasalmus_brandtii"] <- "Serrasalmus brandtii"
SFJQmc_tree$tip.label[SFJQmc_tree$tip.label == "SF_1162_Myleus_micans"] <- "Myleus micans"
SFJQmc_tree$tip.label[SFJQmc_tree$tip.label == "JQ_2984_Hypomasticus_steindachneri"] <- "Hypomasticus steindachneri"
SFJQmc_tree$tip.label[SFJQmc_tree$tip.label == "JQ_4290_Megaleporinus_garmani"] <- "Megaleporinus garmani"
SFJQmc_tree$tip.label[SFJQmc_tree$tip.label == "JQ_1762_Megaleporinus_elongatus"] <- "Megaleporinus elongatus"
SFJQmc_tree$tip.label[SFJQmc_tree$tip.label == "SF_1037_Brycon_orthotaenia"] <- "Brycon orthotaenia"
SFJQmc_tree$tip.label[SFJQmc_tree$tip.label == "SF_1381_Characidium_lagosantense"] <- "Characidium lagosantense"
SFJQmc_tree$tip.label[SFJQmc_tree$tip.label == "1136_Acestrorhynchus_lacustris"] <- "Acestrorhynchus lacustris"
SFJQmc_tree$tip.label[SFJQmc_tree$tip.label == "JQ_7822_Hoplias_malabaricus"] <- "Hoplias malabaricus"
SFJQmc_tree$tip.label[SFJQmc_tree$tip.label == "SF_1377_Hoplias_intermedius_brasiliensis"] <- "Hoplias brasiliensis/intermedius"
SFJQmc_tree$tip.label[SFJQmc_tree$tip.label == "SF_0916_Roeboides_xenodon"] <- "Roeboides xenodon"
SFJQmc_tree$tip.label[SFJQmc_tree$tip.label == "SF_0901_Tetragonopterus_chalceus"] <- "Tetragonopterus chalceus"
SFJQmc_tree$tip.label[SFJQmc_tree$tip.label == "SF_1113_Moenkhausia_sanctaefilomenae"] <- "Moenkhausia sanctaefilomenae"
SFJQmc_tree$tip.label[SFJQmc_tree$tip.label == "SFJQ_7812_Moenkhausia_costae"] <- "Moenkhausia costae"
SFJQmc_tree$tip.label[SFJQmc_tree$tip.label == "SF_1153_Astyanax_cf_fasciatus"] <- "Astyanax fasciatus"
SFJQmc_tree$tip.label[SFJQmc_tree$tip.label == "JQ_7880_Astyanax_lacustris"] <- "Astyanax lacustris"
SFJQmc_tree$tip.label[SFJQmc_tree$tip.label == "SF_1141_Pterygoplichthys_etentaculatus"] <- "Pterygoplichthys etentaculatus"
SFJQmc_tree$tip.label[SFJQmc_tree$tip.label == "SF_1041_Hypostomus_alatus"] <- "Hypostomus alatus"
SFJQmc_tree$tip.label[SFJQmc_tree$tip.label == "JQ_7893_Hypostomus_nigrolineatus"] <- "Hypostomus nigrolineatus"
SFJQmc_tree$tip.label[SFJQmc_tree$tip.label == "SF_1248_Gymnotus_carapo_JQ_1631"] <- "Gymnotus carapo"
SFJQmc_tree$tip.label[SFJQmc_tree$tip.label == "SF_1117_Eigenmannia_virescens"] <- "Eigenmannia virescens"
SFJQmc_tree$tip.label[SFJQmc_tree$tip.label == "JQ_1936_Delturus_brevis"] <- "Delturus brevis"
SFJQmc_tree$tip.label[SFJQmc_tree$tip.label == "SF_0708_Franciscodoras_marmoratus"] <- "Franciscodoras marmoratus"
SFJQmc_tree$tip.label[SFJQmc_tree$tip.label == "JQ_7817_Wertheimeria_maculata"] <- "Wertheimeria maculata"
SFJQmc_tree$tip.label[SFJQmc_tree$tip.label == "SF_1243_Trachelyopterus_galeatus_JQ_5675"] <- "Trachelyopterus galeatus"
SFJQmc_tree$tip.label[SFJQmc_tree$tip.label == "SF_1403_Pimelodus_pohli"] <- "Pimelodus pohli"
SFJQmc_tree$tip.label[SFJQmc_tree$tip.label == "SF_1280_Pimelodus_maculatus"] <- "Pimelodus maculatus"
SFJQmc_tree$tip.label[SFJQmc_tree$tip.label == "1135_Pseudoplatystoma_corruscans"] <- "Pseudoplatystoma corruscans"
SFJQmc_tree$tip.label[SFJQmc_tree$tip.label == "JQ_2996_Steindachneridion_amblyurum"] <- "Steindachneridion amblyurum"
SFJQmc_tree$tip.label[SFJQmc_tree$tip.label == "SF_1104_Microglanis_leptostriatus"] <- "Microglanis leptostriatus"
SFJQmc_tree$tip.label[SFJQmc_tree$tip.label == "SF_1161_Imparfinis_minutus"] <- "Imparfinis minutus"
SFJQmc_tree$tip.label[SFJQmc_tree$tip.label == "JQ_5645_Rhamdia_aff_quelen"] <- "Rhamdia quelen"
SFJQmc_tree$tip.label[SFJQmc_tree$tip.label == "SFJQ_2943_Eugerres_brasilianus"] <- "Eugerres brasilianus"
SFJQmc_tree$tip.label[SFJQmc_tree$tip.label == "SF_1368_Phalloceros_uai"] <- "Phalloceros uai"
SFJQmc_tree$tip.label[SFJQmc_tree$tip.label == "SF_1099_Pamphorichthys_hollandi"] <- "Pamphorichthys hollandi"
SFJQmc_tree$tip.label[SFJQmc_tree$tip.label == "SF_1264_Crenicichla_lepidota"] <- "Crenicichla lepidota"
SFJQmc_tree$tip.label[SFJQmc_tree$tip.label == "JQ_6584_Australoheros_sp"] <- "Australoheros sp"
SFJQmc_tree$tip.label[SFJQmc_tree$tip.label == "304_Geophagus_brasiliensis"] <- "Geophagus brasiliensis"
}
### check if all names have correspondences
SFJQmc_tree$tip.label %in% tab_curated_SFJQ$Species
tab_curated_SFJQ$Species %in% SFJQmc_tree$tip.label
tab_curated_SFJQ$Species[!tab_curated_SFJQ$Species %in% SFJQmc_tree$tip.label]
### convert ape tree to prettier ggtree object
SFJQmc_tree_plot <- ggtree(SFJQmc_tree) +
theme_tree2() +
geom_tiplab(offset = 0,align = T)+
xlim(0, 0.42)
### save tree plot
# ggsave(file = "~/prjcts/fish_eDNA/sfjq/data/trees/SFJQmc-38_SPs_fused-unique-tree_plot.pdf", plot = SFJQmc_tree_plot, device = "pdf", width = 24, height = 24, units = "cm", dpi = 600)
ggsave(file = "~/outros/sfjq_temp/trees/SFJQmc-38_SPs_fused-unique-tree_plot.pdf", plot = SFJQmc_tree_plot, device = "pdf", width = 24, height = 24, units = "cm", dpi = 600)
### extract tips order from tree to reproduce on plots
SPs_order_in_SFJQ_tree <- ggtree::get_taxa_name(SFJQmc_tree_plot) %>% rev()
# SPs_order_in_SFJQ_tree <- extract_tree_data(tree_plot) %>%
# dplyr::filter(isTip) %>%
# dplyr::pull(label)
## plots ----
### RRA histogram ----
# library(ggdist)
SFJQmc_RRA_plot <-
tab_curated_SFJQ %>%
filter(Pool %in% c("SFJQmc")) %>%
mutate(Species = factor(Species,levels = SPs_order_in_SFJQ_tree)) %>%
ggplot(aes(y = Species,
x = `RRA (%)`,
fill = Primer,
col = Normalization
))+
geom_bar(stat = "identity", size = 0.3,width = .75,
# alpha = 0.7,
position = position_dodge(preserve = "single" ,width = 1.1)) +
# position = position_dodgejust(preserve = "single" ,width = 1.2)) +
scale_color_manual(values = c("#000000","#747474")) +
scale_fill_manual(values = colors6[c(1,3)]) +
geom_point(aes(y = Species,
x = `input DNA (%)`),
shape = "|",
size = 3,
colour = "#000000") +
scale_x_break(c(13, 30),
scales = "fixed") +
scale_x_continuous(breaks=c(0,5,10,13,30,32)) +
xlab("Relative read abundance (%)")+
# opts(axis.title.y = theme_text(vjust=-0.5))
theme(axis.text = element_text(vjust = -0.5))
## save plot
# ggsave(file = "~/prjcts/fish_eDNA/sfjq/data/trees/SFJQmc-38_SPs_fused-unique-RRA_barplot.pdf", plot = SFJQmc_RRA_plot, device = "pdf", width = 18, height = 24, units = "cm", dpi = 600)
dev.off()
ggsave(file = "~/outros/sfjq_temp/trees/SFJQmc-38_SPs_fused-unique-RRA_barplot.pdf", plot = SFJQmc_RRA_plot, device = "pdf", width = 30, height = 24, units = "cm", dpi = 600)
# SFmc ----
## build tree ----
### read 12S db seqs for the species present in pools and select only pool species
names(SFJQ_Sps_seqs) %>% sort() %>% paste0(collapse = '",\n"') %>% cat()
SF_Sps_seqs <- SFJQ_Sps_seqs[c("SF_0708_Franciscodoras_marmoratus", "SF_0901_Tetragonopterus_chalceus",
"SF_0916_Roeboides_xenodon", "SF_1037_Brycon_orthotaenia",
"SF_1041_Hypostomus_alatus", "SF_1099_Pamphorichthys_hollandi",
"SF_1104_Microglanis_leptostriatus", "SF_1113_Moenkhausia_sanctaefilomenae",
"SF_1117_Eigenmannia_virescens", "SF_1141_Pterygoplichthys_etentaculatus",
"SF_1153_Astyanax_cf_fasciatus", "SF_1161_Imparfinis_minutus",
"SF_1162_Myleus_micans", "SF_1230_Serrasalmus_brandtii",
"SF_1243_Trachelyopterus_galeatus_JQ_5675", "SF_1248_Gymnotus_carapo_JQ_1631",
"SF_1264_Crenicichla_lepidota", "SF_1280_Pimelodus_maculatus",
"SF_1339_Prochilodus_costatus_JQ_2860", "SF_1368_Phalloceros_uai",
"SF_1377_Hoplias_intermedius_brasiliensis", "SF_1381_Characidium_lagosantense",
"SF_1403_Pimelodus_pohli")]
### align seqs
SF_Sps_algn <- DECIPHER::AlignSeqs(myXStringSet = SF_Sps_seqs,
refinements = 100,
iterations = 100,
verbose = TRUE)
### generate distance matrix
SF_Sps_dist <- DECIPHER::DistanceMatrix(myXStringSet = SF_Sps_algn,
includeTerminalGaps = FALSE,
correction = "Jukes-Cantor",
processors = 20,
verbose = TRUE)
### generate dendrogram/tree from alignment and distance matrix
SFmc_tree <- ape::nj(SF_Sps_dist)
# tree <- phangorn::NJ(SFJQ_Sps_dist)
class(SFmc_tree)
### save tree as newick
# ape::write.tree(phy = SFmc_tree,file = "~/prjcts/fish_eDNA/sfjq/data/trees/SFmc-23_SPs_fused-unique_APEtree.nwk")
ape::write.tree(phy = SFmc_tree,file = "~/outros/sfjq_temp/trees/SFmc-23_SPs_fused-unique_APEtree.nwk")
### read tree from file (or stay with the same object)
SFmc_tree <- read.tree("~/prjcts/fish_eDNA/sfjq/data/trees/SFmc-23_SPs_fused-unique_APEtree.nwk")
SFmc_tree <- read.tree("~/outros/sfjq_temp/trees/SFmc-23_SPs_fused-unique_APEtree.nwk")
## species metadata ----
### read table with pools species, input DNA and RRA
### tidy table
tab_curated_SF <- tab_curated_SFJQ_all_pools %>%
filter(Pool %in% c("SFmc")) %>%
filter(Status %in% c("Expected")) %>%
# filter(MC == "SFJQmc") %>%
# filter(Pool == "SFJQmc") %>%
mutate(Primer = factor(Primer, levels = c("NeoFish","MiFish","Teleo")),
Species = factor(Species),
# `revised final ID` = factor(`revised final ID`),
Normalization = factor(Normalization),
Pool = factor(Pool),
Status = factor(Status),
# `RRA (%)` = as.numeric(`Relative abundance on sample`)*100,
`RRA (%)` = as.numeric(`RRA (%)`),
`input DNA (%)` = as.numeric(`input DNA (%)`))
## correct tips labels ----
### check tip names in tree
SFmc_tree$tip.label
### rename tree tips to mach table
SFmc_tree$tip.label
tab_curated_SF$Species %>% unique() %>% sort()
{
SFmc_tree$tip.label[SFmc_tree$tip.label == "SF_1339_Prochilodus_costatus_JQ_2860"] <- "Prochilodus costatus"
SFmc_tree$tip.label[SFmc_tree$tip.label == "SF_1230_Serrasalmus_brandtii"] <- "Serrasalmus brandtii"
SFmc_tree$tip.label[SFmc_tree$tip.label == "SF_1162_Myleus_micans"] <- "Myleus micans"
SFmc_tree$tip.label[SFmc_tree$tip.label == "SF_1037_Brycon_orthotaenia"] <- "Brycon orthotaenia"
SFmc_tree$tip.label[SFmc_tree$tip.label == "SF_1381_Characidium_lagosantense"] <- "Characidium lagosantense"
SFmc_tree$tip.label[SFmc_tree$tip.label == "SF_1377_Hoplias_intermedius_brasiliensis"] <- "Hoplias intermedius"
SFmc_tree$tip.label[SFmc_tree$tip.label == "SF_0916_Roeboides_xenodon"] <- "Roeboides xenodon"
SFmc_tree$tip.label[SFmc_tree$tip.label == "SF_0901_Tetragonopterus_chalceus"] <- "Tetragonopterus chalceus"
SFmc_tree$tip.label[SFmc_tree$tip.label == "SF_1113_Moenkhausia_sanctaefilomenae"] <- "Moenkhausia sanctaefilomenae"
SFmc_tree$tip.label[SFmc_tree$tip.label == "SF_1153_Astyanax_cf_fasciatus"] <- "Astyanax fasciatus"
SFmc_tree$tip.label[SFmc_tree$tip.label == "SF_1141_Pterygoplichthys_etentaculatus"] <- "Pterygoplichthys etentaculatus"
SFmc_tree$tip.label[SFmc_tree$tip.label == "SF_1041_Hypostomus_alatus"] <- "Hypostomus alatus"
SFmc_tree$tip.label[SFmc_tree$tip.label == "SF_1248_Gymnotus_carapo_JQ_1631"] <- "Gymnotus carapo"
SFmc_tree$tip.label[SFmc_tree$tip.label == "SF_1117_Eigenmannia_virescens"] <- "Eigenmannia virescens"
SFmc_tree$tip.label[SFmc_tree$tip.label == "SF_0708_Franciscodoras_marmoratus"] <- "Franciscodoras marmoratus"
SFmc_tree$tip.label[SFmc_tree$tip.label == "SF_1243_Trachelyopterus_galeatus_JQ_5675"] <- "Trachelyopterus galeatus"
SFmc_tree$tip.label[SFmc_tree$tip.label == "SF_1403_Pimelodus_pohli"] <- "Pimelodus pohli"
SFmc_tree$tip.label[SFmc_tree$tip.label == "SF_1280_Pimelodus_maculatus"] <- "Pimelodus maculatus"
SFmc_tree$tip.label[SFmc_tree$tip.label == "SF_1104_Microglanis_leptostriatus"] <- "Microglanis leptostriatus"
SFmc_tree$tip.label[SFmc_tree$tip.label == "SF_1161_Imparfinis_minutus"] <- "Imparfinis minutus"
SFmc_tree$tip.label[SFmc_tree$tip.label == "SF_1368_Phalloceros_uai"] <- "Phalloceros uai"
SFmc_tree$tip.label[SFmc_tree$tip.label == "SF_1099_Pamphorichthys_hollandi"] <- "Pamphorichthys hollandi"
SFmc_tree$tip.label[SFmc_tree$tip.label == "SF_1264_Crenicichla_lepidota"] <- "Crenicichla lepidota"
}
### check if all names have correspondences
SFmc_tree$tip.label %in% tab_curated_SF$Species
tab_curated_SF$Species %in% SFmc_tree$tip.label
tab_curated_SF$Species[!tab_curated_SF$Species %in% SFmc_tree$tip.label]
### convert ape tree to prettier ggtree object
SFmc_tree_plot <- ggtree(SFmc_tree) +
theme_tree2() +
geom_tiplab(offset = 0,align = T)+
xlim(0, 0.42)
### save tree plot
# ggsave(file = "~/prjcts/fish_eDNA/sfjq/data/trees/SFmc-23_SPs_fused-unique-tree_plot.pdf",
ggsave(file = "~/outros/sfjq_temp/trees/SFmc-23_SPs_fused-unique-tree_plot.pdf",
plot = SFmc_tree_plot,
device = "pdf",
width = 24, height = 20,
units = "cm", dpi = 600)
### extract tips order from tree to reproduce on plots
SPs_order_in_SF_tree <- get_taxa_name(SFmc_tree_plot) %>% rev()
# SPs_order_in_SF_tree <- extract_tree_data(tree_plot) %>%
# dplyr::filter(isTip) %>%
# dplyr::pull(label)
## plots ----
### RRA histogram ----
SFmc_RRA_plot <-
tab_curated_SF %>%
# filter(Normalization %in% c("Normalized")) %>%
unite(Normalization, Primer, col = "Primer_norm",remove = F,sep = " ") %>%
mutate(Primer_norm = factor(Primer_norm, levels = c("Normalized NeoFish","Normalized MiFish","Non-normalized NeoFish","Non-normalized MiFish"))) %>%
mutate(Species = factor(Species,levels = SPs_order_in_SF_tree)) %>%
ggplot(aes(y = Species,
x = `RRA (%)`,
# fill = Primer,
fill = Primer_norm,
col = Normalization
))+
geom_bar(stat = "identity", size = 0.3,width = 1,
# alpha = 0.7,
position = position_dodge(preserve = "single" ,width = 1.5)) +
# position = position_dodgejust(preserve = "single" ,width = 1.2)) +
scale_fill_manual(values = colors6[c(1,3,2,4)], name = "") +
geom_point(aes(y = Species,
x = `input DNA (%)`,
colour = Normalization),
shape = "|",
size = 3) +
scale_color_manual(values = c("#747474","#000000")) +
xlab("Relative read abundance (%)")
# +
# scale_color_manual(values = c("#000000","#848484"))
## save plot
# ggsave(file = "~/prjcts/fish_eDNA/sfjq/data/trees/SFmc-23_SPs_fused-unique-RRA_barplot.pdf",
# plot = SFmc_RRA_plot, device = "pdf", width = 24, height = 20, units = "cm", dpi = 600)
ggsave(file = "~/outros/sfjq_temp/trees/SFmc-23_SPs_fused-unique-RRA_barplot.pdf",
plot = SFmc_RRA_plot, device = "pdf", width = 30, height = 30, units = "cm", dpi = 600)
# JQmc ----
## build tree ----
### read 12S db seqs for the species present in pools and select only pool species
names(SFJQ_Sps_seqs) %>% sort() %>% paste0(collapse = '",\n"') %>% cat()
JQ_Sps_seqs <- SFJQ_Sps_seqs[c("JQ_1762_Megaleporinus_elongatus",
"JQ_1936_Delturus_brevis",
"JQ_2984_Hypomasticus_steindachneri",
"JQ_2996_Steindachneridion_amblyurum",
"JQ_4290_Megaleporinus_garmani",
"JQ_5612_Prochilodus_argenteus_hartii",
"JQ_5645_Rhamdia_aff_quelen",
"JQ_6584_Australoheros_sp",
"JQ_6586_Steindachnerina_elegans-Cyphocharax_gilbert",
"JQ_7817_Wertheimeria_maculata",
"JQ_7822_Hoplias_malabaricus",
"JQ_7880_Astyanax_lacustris",
"JQ_7893_Hypostomus_nigrolineatus",
"SF_1243_Trachelyopterus_galeatus_JQ_5675",
"SF_1248_Gymnotus_carapo_JQ_1631",
"SF_1339_Prochilodus_costatus_JQ_2860",
"SF_1377_Hoplias_intermedius_brasiliensis")]
### align seqs
JQ_Sps_algn <- DECIPHER::AlignSeqs(myXStringSet = JQ_Sps_seqs,
refinements = 100,
iterations = 100,
verbose = TRUE)
### generate distance matrix
JQ_Sps_dist <- DECIPHER::DistanceMatrix(myXStringSet = JQ_Sps_algn,
includeTerminalGaps = FALSE,
correction = "Jukes-Cantor",
processors = 20,
verbose = TRUE)
### generate dendrogram/tree from alignment and distance matrix
JQmc_tree <- ape::nj(JQ_Sps_dist)
# tree <- phangorn::NJ(SFJQ_Sps_dist)
class(JQmc_tree)
### save tree as newick
# ape::write.tree(phy = JQmc_tree,file = "~/prjcts/fish_eDNA/sfjq/data/trees/JQmc-23_SPs_fused-unique_APEtree.nwk")
ape::write.tree(phy = JQmc_tree,file = "~/outros/sfjq_temp/trees/JQmc-23_SPs_fused-unique_APEtree.nwk")
### read tree from file (or stay with the same object)
JQmc_tree <- read.tree("~/prjcts/fish_eDNA/sfjq/data/trees/JQmc-23_SPs_fused-unique_APEtree.nw")
# JQmc_tree <- read.tree("~/outros/sfjq_temp/trees/JQmc-23_SPs_fused-unique_APEtree.nwk")
## species metadata ----
### read table with pools species, input DNA and RRA
### tidy table
tab_curated_JQ <- tab_curated_SFJQ_all_pools %>%
filter(Pool %in% c("JQmc")) %>%
filter(Status %in% c("Expected")) %>%
# filter(MC == "SFJQmc") %>%
# filter(Pool == "SFJQmc") %>%
mutate(Primer = factor(Primer, levels = c("NeoFish","MiFish","Teleo")),
Species = factor(Species),
# `revised final ID` = factor(`revised final ID`),
Normalization = factor(Normalization),
Pool = factor(Pool),
Status = factor(Status),
# `RRA (%)` = as.numeric(`Relative abundance on sample`)*100,
`RRA (%)` = as.numeric(`RRA (%)`),
`input DNA (%)` = as.numeric(`input DNA (%)`))
## correct tips labels ----
### check tip names in tree
JQmc_tree$tip.label
### rename tree tips to mach table
JQmc_tree$tip.label
tab_curated_JQ$Species %>% unique() %>% sort()
{
JQmc_tree$tip.label[JQmc_tree$tip.label == "SF_1339_Prochilodus_costatus_JQ_2860"] <- "Prochilodus costatus"
JQmc_tree$tip.label[JQmc_tree$tip.label == "JQ_5612_Prochilodus_argenteus_hartii"] <- "Prochilodus argenteus/hartii"
JQmc_tree$tip.label[JQmc_tree$tip.label == "JQ_6586_Steindachnerina_elegans-Cyphocharax_gilbert"] <- "Cyphocharax gilbert"
JQmc_tree$tip.label[JQmc_tree$tip.label == "JQ_2984_Hypomasticus_steindachneri"] <- "Hypomasticus steindachneri"
JQmc_tree$tip.label[JQmc_tree$tip.label == "JQ_4290_Megaleporinus_garmani"] <- "Megaleporinus garmani"
JQmc_tree$tip.label[JQmc_tree$tip.label == "JQ_1762_Megaleporinus_elongatus"] <- "Megaleporinus elongatus"
JQmc_tree$tip.label[JQmc_tree$tip.label == "JQ_7822_Hoplias_malabaricus"] <- "Hoplias malabaricus"
JQmc_tree$tip.label[JQmc_tree$tip.label == "SF_1377_Hoplias_intermedius_brasiliensis"] <- "Hoplias brasiliensis"
JQmc_tree$tip.label[JQmc_tree$tip.label == "JQ_7880_Astyanax_lacustris"] <- "Astyanax lacustris"
JQmc_tree$tip.label[JQmc_tree$tip.label == "JQ_7893_Hypostomus_nigrolineatus"] <- "Hypostomus nigrolineatus"
JQmc_tree$tip.label[JQmc_tree$tip.label == "SF_1248_Gymnotus_carapo_JQ_1631"] <- "Gymnotus carapo"
JQmc_tree$tip.label[JQmc_tree$tip.label == "JQ_1936_Delturus_brevis"] <- "Delturus brevis"
JQmc_tree$tip.label[JQmc_tree$tip.label == "JQ_7817_Wertheimeria_maculata"] <- "Wertheimeria maculata"
JQmc_tree$tip.label[JQmc_tree$tip.label == "SF_1243_Trachelyopterus_galeatus_JQ_5675"] <- "Trachelyopterus galeatus"
JQmc_tree$tip.label[JQmc_tree$tip.label == "JQ_2996_Steindachneridion_amblyurum"] <- "Steindachneridion amblyurum"
JQmc_tree$tip.label[JQmc_tree$tip.label == "JQ_5645_Rhamdia_aff_quelen"] <- "Rhamdia quelen"
JQmc_tree$tip.label[JQmc_tree$tip.label == "JQ_6584_Australoheros_sp"] <- "Australoheros sp"
}
### check if all names have correspondences
JQmc_tree$tip.label %in% tab_curated_JQ$Species
tab_curated_JQ$Species %in% JQmc_tree$tip.label
tab_curated_JQ$Species[!tab_curated_JQ$Species %in% JQmc_tree$tip.label]
#invert branches to match Siluriformes position on the top
JQmc_tree$edge
JQmc_tree %>% as_tibble() %>% View()
JQmc_tree %>%
ggtree() +
# geom_text(aes(label=node)) +
theme_tree2() +
geom_tiplab(offset = 0,align = T)+
xlim(0, 0.42)%>%
ggtree::flip(node1 = 21,node2 = 20)
rotateNodes(tree = JQmc_tree, "all") %>%
ggtree() +
theme_tree2() +
geom_tiplab(offset = 0,align = T)+
xlim(0, 0.42)
### convert ape tree to prettier ggtree object
JQmc_tree_plot <- ggtree(JQmc_tree) +
theme_tree2() +
geom_tiplab(offset = 0,align = T)+
xlim(0, 0.42)
### save tree plot
# ggsave(file = "~/prjcts/fish_eDNA/sfjq/data/trees/JQmc-17_SPs_fused-unique-tree_plot.pdf",
ggsave(file = "~/outros/sfjq_temp/trees/JQmc-17_SPs_fused-unique-tree_plot.pdf",
plot = JQmc_tree_plot,
device = "pdf",
width = 24, height = 24,
units = "cm", dpi = 600)
### extract tips order from tree to reproduce on plots
SPs_order_in_JQ_tree <- get_taxa_name(JQmc_tree_plot) %>% rev()
# SPs_order_in_JQ_tree <- extract_tree_data(tree_plot) %>%
# dplyr::filter(isTip) %>%
# dplyr::pull(label)
## plots ----
### RRA histogram ----
JQmc_RRA_plot <-
tab_curated_JQ %>%
unite(Normalization, Primer, col = "Primer_norm",remove = F,sep = " ") %>%
mutate(Primer_norm = factor(Primer_norm, levels = c("Normalized NeoFish","Normalized MiFish","Normalized Teleo","Non-normalized NeoFish","Non-normalized MiFish","Non-normalized Teleo"))) %>%
mutate(Species = factor(Species,levels = SPs_order_in_JQ_tree)) %>%
ggplot(aes(y = Species,
x = `RRA (%)`,
fill = Primer_norm,
col = Normalization
))+
geom_bar(stat = "identity", size = 0.3,width = 1,
# alpha = 0.7,
position = position_dodge(preserve = "single" ,width = 1.5)) +
# position = position_dodgejust(preserve = "single" ,width = 1.2)) +
scale_fill_manual(values = colors6[c(1,3,5,2,4,6)], name = "") +
geom_point(aes(y = Species,
x = `input DNA (%)`,
colour = Normalization),
shape = "|",
size = 3) +
scale_color_manual(values = c("#747474","#000000")) +
xlab("Relative read abundance (%)")
## save plot
# ggsave(file = "~/prjcts/fish_eDNA/sfjq/data/trees/JQmc-23_SPs_fused-unique-RRA_barplot.pdf", plot = JQmc_RRA_plot, device = "pdf", width = 24, height = 20, units = "cm", dpi = 600)
ggsave(file = "~/outros/sfjq_temp/trees/JQmc-17_SPs_fused-unique-RRA_barplot.pdf", plot = JQmc_RRA_plot, device = "pdf", width = 30, height = 30, units = "cm", dpi = 600)
#arvore ----
# SFJQmc_tree <- read.tree("~/prjcts/fish_eDNA/sfjq/data/12S_full_SFJQmc_fused_SPs_e_3_contams.nwk")
ggplot(SFJQmc_tree) + geom_tree() + theme_tree()
# This is convenient shorthand
# # tree_plot <-
# ggtree(SFJQmc_tree) +
# theme_tree2() +
# geom_tiplab(offset = 0,align = T)+
# xlim(0, 0.42)
tree_plot
#TODO create function to build double graph of tree and bars
# newick tree to plot along the graph
tree4plot <- SFJQmc_tree
# table for ggplot to go alongside the tree (long format, can have factors)
tbl4plot <- tab_curated_SFJQ
# plot to put by side (y axis must be the species in tree (column name == Species))
plot4tree <- SFJQmc_RRA_plot
### generate plot from plylo object (.nwk read by ape::read.tree)
class(SFJQmc_tree)
tree4plot$edge.length %>% sort() %>% sum()
tree4plot %>% str()
tree_plot$data
# tree_plot <-
ggtree(tr = tree4plot,layout = "rectangular") +
theme_tree2() +
# geom_tiplab(offset = 0,align = T)+
geom_tiplab(align = T)+
xlim(0, 0.42)
### extract tips order from tree to reproduce on plots
SPs_order_in_tree <- ggtree::get_taxa_name(SFJQmc_tree_plot) %>% rev()
plot4tree$data %>%
dplyr::mutate(Species = factor(Species, levels = SPs_order_in_tree))
## check tip names in tree
JQmc_tree$tip.label
### convert ape tree to prettier ggtree object
JQmc_tree_plot <- ggtree(JQmc_tree) +
theme_tree2() +
geom_tiplab(offset = 0,align = T)+
xlim(0, 0.42)
treeNbar_plot <- function(){
}
# https://www.r-bloggers.com/2016/12/add-layer-to-specific-panel-of-facet_plot-output-2/
# facet_plot(tree_plot, panel = 'Stacked Barplot',
# data = tab_curated_SFJQ, geom = geom_histogram,
# mapping = aes(x = Species,y =`RRA (%)`, fill = as.factor(Primer)),
# stat='identity',position = 'dodge' )
#
# #
# p3 <- facet_plot(tree_plot, panel='bar', data=tab_curated_SFJQ, geom=geom_bar,
# aes(x=`RRA (%)`, y=Species,fill = Primer),
# stat = "identity",
# position = "dodge")
#https://oup.silverchair-cdn.com/oup/backfile/Content_public/Journal/mbe/35/12/10.1093_molbev_msy194/3/msy194_supp.pdf?Expires=1648204036&Signature=gZC6A1vfyaUWOyL~fKn8wxgY~3fbTBI3jPOGbVtwZSzv3jlXISjCahA37gwR3QTr6oN0SK-bdwAlHQyaPpkdj2~yi5scNQXAQrUi0EQNOqkOo3HUvFvCr-Dir2y7N03vIo5urr1n2idrPclTXtTRtiu7avn255T5eg~cXv0NBNUgiVFcwHHnZ81qQUrSdiA54wIvEs~RF18DYkp-Gla1CJT0eUGuYF8LfFXG5Dq1CgcZV0qGs0fKgfIKRlAT~AP25Xxkdh20RzAkqgBFvxp0JazrVOz5uvdok3uSu3023etErTxhaW7rm67VkCUBVxRgtG8GdFT3fOFJAsPg26Wagw__&Key-Pair-Id=APKAIE5G5CRDK6RD3PGA
#
# tree_plot %<+% tab_curated_SFJQ +
# geom_histogram(aes(y = Species,
# x = `RRA (%)`,
# fill = Primer),
# stat = "identity",
# position = "dodge")
colnames(tab_curated_SFJQ)[colnames(tab_curated_SFJQ) == "Species"] <- "tip.label"
p2 <-
facet_plot(p = tree_plot, panel = "SNP", data = tab_curated_SFJQ, geom = geom_histogram,
mapping=aes(y = tip.label, x = `RRA (%)`, fill = Primer),
stat = "identity",
position = "dodge") +
# %>%
# facet_plot("Trait", bar_data, ggstance::geom_barh,
# aes(x = dummy_bar_value, color = location, fill = location),
# stat = "identity", width = .6) +
theme_tree2(legend.position=c(.05, .85))
print(p2)
p2 <- tree_plot + geom_facet(panel = "RRA (%)",
data = tab_curated_SFJQ,
geom = geom_bar,
mapping = aes(x=`RRA (%)`, fill = Primer),orientation = 'y',stat="identity")
extract_tree_data <- function(tree_disp, displayorder=TRUE) {
td_out <- tree_disp$data
if (displayorder) {
td_out <- dplyr::arrange(td_out,y)
}
return(td_out)
}
SPs_order_in_tree <- extract_tree_data(tree_plot) %>%
dplyr::filter(isTip) %>%
dplyr::pull(label)dendrograms of ASVs & db species
fold change standard deviation
References
This analyses were based and inpired on other incredible resources, listed below:
#Bonus
NeoFish redesign
This is a dinamic report, intended to show the current state of analyses. Many procedures and conclusions might change as the pipeline evolves. If you notice errors/mistakes/typos, or have any suggestions, we would be glad to know. heronoh@gmail.com